ID: 1198274885

View in Genome Browser
Species Human (GRCh38)
Location X:135090829-135090851
Sequence GGGCTCCTGGCTCTAACCCT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1198274885_1198274897 19 Left 1198274885 X:135090829-135090851 CCCAGGGTTAGAGCCAGGAGCCC No data
Right 1198274897 X:135090871-135090893 CGAGCCTGCCAGCATGGGAGGGG No data
1198274885_1198274894 14 Left 1198274885 X:135090829-135090851 CCCAGGGTTAGAGCCAGGAGCCC No data
Right 1198274894 X:135090866-135090888 GTGGGCGAGCCTGCCAGCATGGG No data
1198274885_1198274893 13 Left 1198274885 X:135090829-135090851 CCCAGGGTTAGAGCCAGGAGCCC No data
Right 1198274893 X:135090865-135090887 TGTGGGCGAGCCTGCCAGCATGG No data
1198274885_1198274896 18 Left 1198274885 X:135090829-135090851 CCCAGGGTTAGAGCCAGGAGCCC No data
Right 1198274896 X:135090870-135090892 GCGAGCCTGCCAGCATGGGAGGG No data
1198274885_1198274889 -5 Left 1198274885 X:135090829-135090851 CCCAGGGTTAGAGCCAGGAGCCC No data
Right 1198274889 X:135090847-135090869 AGCCCAGACTAAAGGCAGTGTGG No data
1198274885_1198274890 -4 Left 1198274885 X:135090829-135090851 CCCAGGGTTAGAGCCAGGAGCCC No data
Right 1198274890 X:135090848-135090870 GCCCAGACTAAAGGCAGTGTGGG No data
1198274885_1198274895 17 Left 1198274885 X:135090829-135090851 CCCAGGGTTAGAGCCAGGAGCCC No data
Right 1198274895 X:135090869-135090891 GGCGAGCCTGCCAGCATGGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1198274885 Original CRISPR GGGCTCCTGGCTCTAACCCT GGG (reversed) Intergenic
No off target data available for this crispr