ID: 1198274887

View in Genome Browser
Species Human (GRCh38)
Location X:135090839-135090861
Sequence GAGCCAGGAGCCCAGACTAA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1198274875_1198274887 30 Left 1198274875 X:135090786-135090808 CCATTAACTACAAGGCCAAGACA No data
Right 1198274887 X:135090839-135090861 GAGCCAGGAGCCCAGACTAAAGG No data
1198274879_1198274887 6 Left 1198274879 X:135090810-135090832 CCATGTCCAAGGAGAAGGCCCCA No data
Right 1198274887 X:135090839-135090861 GAGCCAGGAGCCCAGACTAAAGG No data
1198274877_1198274887 15 Left 1198274877 X:135090801-135090823 CCAAGACATCCATGTCCAAGGAG No data
Right 1198274887 X:135090839-135090861 GAGCCAGGAGCCCAGACTAAAGG No data
1198274882_1198274887 0 Left 1198274882 X:135090816-135090838 CCAAGGAGAAGGCCCCAGGGTTA No data
Right 1198274887 X:135090839-135090861 GAGCCAGGAGCCCAGACTAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1198274887 Original CRISPR GAGCCAGGAGCCCAGACTAA AGG Intergenic
No off target data available for this crispr