ID: 1198274890

View in Genome Browser
Species Human (GRCh38)
Location X:135090848-135090870
Sequence GCCCAGACTAAAGGCAGTGT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1198274884_1198274890 -3 Left 1198274884 X:135090828-135090850 CCCCAGGGTTAGAGCCAGGAGCC No data
Right 1198274890 X:135090848-135090870 GCCCAGACTAAAGGCAGTGTGGG No data
1198274877_1198274890 24 Left 1198274877 X:135090801-135090823 CCAAGACATCCATGTCCAAGGAG No data
Right 1198274890 X:135090848-135090870 GCCCAGACTAAAGGCAGTGTGGG No data
1198274879_1198274890 15 Left 1198274879 X:135090810-135090832 CCATGTCCAAGGAGAAGGCCCCA No data
Right 1198274890 X:135090848-135090870 GCCCAGACTAAAGGCAGTGTGGG No data
1198274882_1198274890 9 Left 1198274882 X:135090816-135090838 CCAAGGAGAAGGCCCCAGGGTTA No data
Right 1198274890 X:135090848-135090870 GCCCAGACTAAAGGCAGTGTGGG No data
1198274886_1198274890 -5 Left 1198274886 X:135090830-135090852 CCAGGGTTAGAGCCAGGAGCCCA No data
Right 1198274890 X:135090848-135090870 GCCCAGACTAAAGGCAGTGTGGG No data
1198274885_1198274890 -4 Left 1198274885 X:135090829-135090851 CCCAGGGTTAGAGCCAGGAGCCC No data
Right 1198274890 X:135090848-135090870 GCCCAGACTAAAGGCAGTGTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1198274890 Original CRISPR GCCCAGACTAAAGGCAGTGT GGG Intergenic
No off target data available for this crispr