ID: 1198276639

View in Genome Browser
Species Human (GRCh38)
Location X:135100282-135100304
Sequence TTAAAAACTCATGAGGAGGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1198276639_1198276642 -8 Left 1198276639 X:135100282-135100304 CCATCCTCCTCATGAGTTTTTAA No data
Right 1198276642 X:135100297-135100319 GTTTTTAAAATGATGTTTGATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1198276639 Original CRISPR TTAAAAACTCATGAGGAGGA TGG (reversed) Intergenic
No off target data available for this crispr