ID: 1198276812

View in Genome Browser
Species Human (GRCh38)
Location X:135102357-135102379
Sequence TTAAAAACTCATGAGGAGGA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1198276808_1198276812 -8 Left 1198276808 X:135102342-135102364 CCATCAAACACCATTTTAAAAAC No data
Right 1198276812 X:135102357-135102379 TTAAAAACTCATGAGGAGGATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1198276812 Original CRISPR TTAAAAACTCATGAGGAGGA TGG Intergenic
No off target data available for this crispr