ID: 1198278907

View in Genome Browser
Species Human (GRCh38)
Location X:135123325-135123347
Sequence CATCTGCGTGGAGCATCAGG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 112
Summary {0: 1, 1: 1, 2: 1, 3: 6, 4: 103}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1198278907 Original CRISPR CATCTGCGTGGAGCATCAGG AGG Intergenic
901727797 1:11255932-11255954 CATCTGCGTAGAGAATCACCTGG - Intronic
902088456 1:13881674-13881696 TATCTGTCTGGAGCATCTGGTGG + Intergenic
903301234 1:22380021-22380043 CACCTGCGTGTGGCATTAGGCGG + Intergenic
904500321 1:30909136-30909158 CACGTGCGTGGAGCCACAGGGGG - Intergenic
913196495 1:116460718-116460740 CTTCTGGGAGGAGCATAAGGGGG - Intergenic
921301272 1:213753636-213753658 AAGCTGCCTGCAGCATCAGGTGG - Intergenic
1063545811 10:6980437-6980459 CATCTGAATGAAGCAGCAGGTGG + Intergenic
1064644287 10:17445051-17445073 CATCTATTTGGAGCATGAGGTGG + Intronic
1064672097 10:17725719-17725741 CAATGTCGTGGAGCATCAGGGGG - Intergenic
1066095338 10:32066843-32066865 CATTTTAGTGGAGCTTCAGGGGG + Intergenic
1066953787 10:42146899-42146921 CATCTGCAGGGATCTTCAGGAGG + Intergenic
1067546269 10:47194679-47194701 CATCTGCATGGAGTTTCTGGGGG + Intergenic
1068597623 10:58920075-58920097 TACCTGAGTGGAGCTTCAGGAGG + Intergenic
1069960014 10:72073980-72074002 CCTCTGCGTGGGGCTCCAGGAGG + Intronic
1071860064 10:89663249-89663271 CATGTGACTGGAGCATCATGAGG + Intergenic
1072674166 10:97453221-97453243 CATCTGTGTGGAACAGCAGCTGG - Intronic
1074727340 10:116325041-116325063 CATCTTCACCGAGCATCAGGCGG + Exonic
1076078226 10:127554680-127554702 CATCTGCGAGGACAAGCAGGTGG + Intergenic
1076136626 10:128049588-128049610 CATCCCCGTGGAGCACCTGGAGG + Exonic
1083483443 11:62965451-62965473 CAGCTACGTGGAGGATGAGGTGG - Intronic
1084399282 11:68934345-68934367 CACCTGAGTGGAGGATCAGCTGG + Intronic
1084638640 11:70410841-70410863 CATCTGGCTGGTGCATGAGGTGG - Intronic
1085642415 11:78200712-78200734 CAGCTGCCTGGAGCAGCTGGCGG + Exonic
1086576542 11:88344692-88344714 CATCTGCCTAGAAGATCAGGAGG - Intergenic
1089304715 11:117519264-117519286 CCTCTGCGTGGGGCCTCAGGAGG + Intronic
1090085690 11:123648938-123648960 CATTTGCATGGAGCAGCAGAAGG + Intronic
1090205183 11:124879926-124879948 CATCTGGGTGGAGCACCCGCTGG - Exonic
1090318277 11:125817195-125817217 CAGGTGGGTAGAGCATCAGGTGG - Intergenic
1091832456 12:3559701-3559723 CATCTGCCTGGGGCAGGAGGTGG - Intronic
1091851259 12:3698958-3698980 CATCTCCTGGGAGCAGCAGGTGG - Intronic
1092335589 12:7629737-7629759 CATCTTTCCGGAGCATCAGGAGG + Intergenic
1093429600 12:19069760-19069782 CATGTGCCTGTAGCCTCAGGAGG + Intergenic
1103538117 12:121647510-121647532 AATGTGGGTGGAGCATCAGCAGG + Intergenic
1104017066 12:124968531-124968553 CACCTGCGGGCAGCATCCGGTGG + Exonic
1104601406 12:130156341-130156363 CATCTCCGTGGAGAGGCAGGAGG + Intergenic
1111247128 13:85554273-85554295 TCTCTGAGGGGAGCATCAGGTGG - Intergenic
1114778124 14:25509428-25509450 CATCTCAGGGGAGCAGCAGGTGG - Intergenic
1121719630 14:96100360-96100382 CATAGGCCTGCAGCATCAGGGGG + Intergenic
1122024344 14:98864293-98864315 CATCTGGGTGGTGCATGAGAAGG + Intergenic
1129752489 15:78076108-78076130 CACCTGCTTTGAGCATCTGGAGG - Intronic
1131322747 15:91411014-91411036 CATTTGAGTGGAGCCTCAAGGGG - Intergenic
1132869837 16:2111026-2111048 CATCTGCGTGGAGCCAGAGGTGG - Exonic
1134717584 16:16364575-16364597 CATCTGCGTGGAGCCAGAGGTGG + Intergenic
1134957168 16:18387584-18387606 CATCTGCGTGGAGCCAGAGGTGG - Intergenic
1139340046 16:66262577-66262599 CAACTGCAGGTAGCATCAGGTGG + Intergenic
1141116485 16:81314278-81314300 CTCCTGCGTGGAGAATAAGGCGG - Intergenic
1141949541 16:87331727-87331749 CCTCTGCGTCCATCATCAGGTGG - Intronic
1145035630 17:19538636-19538658 CATCTGAGTTGAGAGTCAGGTGG + Intronic
1150398358 17:64837902-64837924 CAGCTGCGTGGAGGCTGAGGTGG - Intergenic
1151450810 17:74197156-74197178 CATCTGTCTGGAGCATCCCGAGG + Intergenic
1154271210 18:12921462-12921484 TATCTGCGTGTAGCACAAGGAGG + Intronic
1160189738 18:76705754-76705776 AGTCTGGGTGCAGCATCAGGAGG + Intergenic
1164864950 19:31597020-31597042 CATCAGGGAAGAGCATCAGGCGG + Intergenic
1165108536 19:33488182-33488204 CATCTGCGTGGTGGGCCAGGTGG - Intronic
926220327 2:10931904-10931926 CATCTGCCAGGAGCAGCAGGTGG - Intergenic
927086715 2:19679491-19679513 CATCAGCATGGAGCATGAAGAGG - Intergenic
929176906 2:38987510-38987532 CGTCTTCGTGGAGGAACAGGAGG + Exonic
937813858 2:126229426-126229448 CAGCTGCGTGGATCCTCAGTGGG + Intergenic
937859416 2:126696373-126696395 CACCTCCGTGGAGCAAAAGGTGG - Exonic
937870193 2:126781014-126781036 CATCTGCCTGGTGAACCAGGAGG - Intergenic
942499825 2:176577890-176577912 CATCTTCCTGTAGTATCAGGGGG - Intergenic
946723654 2:222639322-222639344 CATATGCATGGAGAAACAGGAGG - Intronic
948661590 2:239510237-239510259 CACCTGCCTGGAGCAGAAGGTGG - Intergenic
948694751 2:239727544-239727566 CACCCGGGTGCAGCATCAGGTGG + Intergenic
1171118370 20:22547008-22547030 CATCTGGGGTGAGCATGAGGAGG - Intergenic
1176171178 20:63697046-63697068 CCTCTGCGGGGAGCGTGAGGAGG + Exonic
1180231666 21:46430197-46430219 CCTCTGCGAGGTGCAGCAGGAGG + Exonic
1181822426 22:25486455-25486477 GATCATGGTGGAGCATCAGGAGG - Intergenic
1183086408 22:35489875-35489897 CATCTGAGCAGAGCCTCAGGTGG - Intergenic
1184303716 22:43579985-43580007 CATCTGCGTGGTGCTTTAGACGG - Intronic
1184984248 22:48118636-48118658 CATCTGCTTAGAGGATGAGGTGG + Intergenic
953420449 3:42749825-42749847 CCTCTGCTTGGGGCTTCAGGAGG - Intronic
954417454 3:50400330-50400352 CACCTGCTTGGAGCAGGAGGTGG - Intronic
954710336 3:52502265-52502287 CATCTGCGTGGGCCCCCAGGTGG - Intronic
955349084 3:58180723-58180745 CATCAGGGTGGGGCAGCAGGAGG - Intergenic
961319106 3:126060775-126060797 CAGCTGCACGGAGCAGCAGGTGG + Intronic
968132095 3:196197880-196197902 CATGGAGGTGGAGCATCAGGAGG - Intronic
968728440 4:2258943-2258965 CATCTGCCTGGAGGATAACGAGG + Intronic
969602712 4:8186414-8186436 CTTCTGCGTGGAGCAGAAGACGG + Intronic
971457043 4:26854891-26854913 CAGCTGCCTGGAGCGGCAGGTGG + Intergenic
979370071 4:119875006-119875028 TATCTTCTTGGAGCATCATGTGG - Intergenic
982606911 4:157527211-157527233 CATCTGAGGGGAGTGTCAGGTGG + Intergenic
985579628 5:689889-689911 CATCTGGGTGGAGGATCATCTGG + Intronic
985594474 5:781948-781970 CATCTGGGTGGAGGATCATCTGG + Intergenic
986210344 5:5665681-5665703 CAGCTGCGAGGAGCTGCAGGAGG + Intergenic
986327622 5:6688280-6688302 CCTCTGCGTCCAGCATCACGTGG - Intergenic
999964972 5:156799476-156799498 CCTCTGAGTGGAGCCTCTGGAGG + Intergenic
1019875830 7:3809739-3809761 CCTCTGCGGGCAGCATCACGTGG + Intronic
1022561680 7:31355886-31355908 CATCAGCCTGGAGCTGCAGGTGG + Intergenic
1034940498 7:155227350-155227372 CAGCTGGGTGGAGAATCAGCAGG + Intergenic
1037590944 8:20311531-20311553 AATCTGGGAGGAGCATAAGGGGG + Intergenic
1038504408 8:28072137-28072159 CTTGAGCGTGGAGCATGAGGTGG - Intronic
1039908915 8:41808729-41808751 CATCTGTGTGCAGCAGTAGGGGG - Intronic
1042019027 8:64350085-64350107 CATCTGCGTAGAGTATGATGTGG + Intergenic
1045502657 8:102755438-102755460 CATCAGAGTGGAGCATCGTGAGG + Intergenic
1048297103 8:133222505-133222527 CATCTGCTTGGAGCTGCTGGTGG + Intronic
1048331832 8:133475899-133475921 CATCTGCTTGGGGAACCAGGTGG + Exonic
1051048291 9:12901605-12901627 CATCTGTGTGGGGCGTGAGGTGG - Intergenic
1053109436 9:35444891-35444913 CATCTTAATGGAGCATCAGGAGG - Intergenic
1055593571 9:77843268-77843290 CAGATGGGTGGAGCATTAGGCGG + Intronic
1056955854 9:91080462-91080484 CATCAGCAGGGATCATCAGGGGG + Intergenic
1057653368 9:96935535-96935557 TCTCAGCGTGGAGCATGAGGAGG + Intronic
1058426370 9:104878482-104878504 GAACTGCCTGGAGCAGCAGGGGG + Intronic
1058540095 9:106002821-106002843 AATGTGCCTGGAGCAGCAGGAGG + Intergenic
1060172016 9:121469560-121469582 CAGCAGCGTGGAGAATGAGGTGG + Intergenic
1062641634 9:137521589-137521611 CAGCTGCATGGAGCAGCATGGGG + Intronic
1185649349 X:1637365-1637387 CGTCCTCGTGAAGCATCAGGAGG - Intronic
1192554845 X:72081264-72081286 GGTCTGCGTGGGGCCTCAGGAGG + Intergenic
1198278907 X:135123325-135123347 CATCTGCGTGGAGCATCAGGAGG + Intergenic
1198292052 X:135249195-135249217 CATCTGCATGGAGCATCAGGAGG - Intronic
1198298064 X:135306172-135306194 CATCTGCACAGAGCACCAGGAGG - Intronic
1198306869 X:135392092-135392114 CATCTGCACGGAGCATCAGGAGG - Intergenic