ID: 1198279415

View in Genome Browser
Species Human (GRCh38)
Location X:135126907-135126929
Sequence GTCTGTCAGGGGAAGGGGAC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1198279408_1198279415 -1 Left 1198279408 X:135126885-135126907 CCTGCAAAGCAGCTCTTGGTGAG No data
Right 1198279415 X:135126907-135126929 GTCTGTCAGGGGAAGGGGACAGG No data
1198279407_1198279415 0 Left 1198279407 X:135126884-135126906 CCCTGCAAAGCAGCTCTTGGTGA No data
Right 1198279415 X:135126907-135126929 GTCTGTCAGGGGAAGGGGACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1198279415 Original CRISPR GTCTGTCAGGGGAAGGGGAC AGG Intergenic
No off target data available for this crispr