ID: 1198279655

View in Genome Browser
Species Human (GRCh38)
Location X:135129115-135129137
Sequence GTCATCATGAGAAAATCACC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1198279649_1198279655 2 Left 1198279649 X:135129090-135129112 CCTCTCGAAAACCCGTAACCCCA No data
Right 1198279655 X:135129115-135129137 GTCATCATGAGAAAATCACCTGG No data
1198279651_1198279655 -10 Left 1198279651 X:135129102-135129124 CCGTAACCCCAGTGTCATCATGA No data
Right 1198279655 X:135129115-135129137 GTCATCATGAGAAAATCACCTGG No data
1198279650_1198279655 -9 Left 1198279650 X:135129101-135129123 CCCGTAACCCCAGTGTCATCATG No data
Right 1198279655 X:135129115-135129137 GTCATCATGAGAAAATCACCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1198279655 Original CRISPR GTCATCATGAGAAAATCACC TGG Intergenic
No off target data available for this crispr