ID: 1198280675

View in Genome Browser
Species Human (GRCh38)
Location X:135138861-135138883
Sequence GTGATAGGGATCCCTCACTG GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1198280666_1198280675 21 Left 1198280666 X:135138817-135138839 CCATTTAGAGACATGGTGGAGGG No data
Right 1198280675 X:135138861-135138883 GTGATAGGGATCCCTCACTGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1198280675 Original CRISPR GTGATAGGGATCCCTCACTG GGG Intergenic