ID: 1198286499

View in Genome Browser
Species Human (GRCh38)
Location X:135196511-135196533
Sequence CCTTATATGAAGAGGGATAT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1198286499_1198286505 -2 Left 1198286499 X:135196511-135196533 CCAATATCCCTCTTCATATAAGG No data
Right 1198286505 X:135196532-135196554 GGACACCACTCACTGGATTAGGG No data
1198286499_1198286506 -1 Left 1198286499 X:135196511-135196533 CCAATATCCCTCTTCATATAAGG No data
Right 1198286506 X:135196533-135196555 GACACCACTCACTGGATTAGGGG No data
1198286499_1198286508 25 Left 1198286499 X:135196511-135196533 CCAATATCCCTCTTCATATAAGG No data
Right 1198286508 X:135196559-135196581 ATGATTAACCCTAATGCTGTAGG No data
1198286499_1198286504 -3 Left 1198286499 X:135196511-135196533 CCAATATCCCTCTTCATATAAGG No data
Right 1198286504 X:135196531-135196553 AGGACACCACTCACTGGATTAGG No data
1198286499_1198286503 -9 Left 1198286499 X:135196511-135196533 CCAATATCCCTCTTCATATAAGG No data
Right 1198286503 X:135196525-135196547 CATATAAGGACACCACTCACTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1198286499 Original CRISPR CCTTATATGAAGAGGGATAT TGG (reversed) Intergenic
No off target data available for this crispr