ID: 1198290284

View in Genome Browser
Species Human (GRCh38)
Location X:135233653-135233675
Sequence GTGATAGGGATCCCTCACTG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1198290284_1198290293 21 Left 1198290284 X:135233653-135233675 CCCCAGTGAGGGATCCCTATCAC No data
Right 1198290293 X:135233697-135233719 CCCTCCACCATGTCTCTAAATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1198290284 Original CRISPR GTGATAGGGATCCCTCACTG GGG (reversed) Intergenic