ID: 1198290286

View in Genome Browser
Species Human (GRCh38)
Location X:135233655-135233677
Sequence AGGTGATAGGGATCCCTCAC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1198290286_1198290293 19 Left 1198290286 X:135233655-135233677 CCAGTGAGGGATCCCTATCACCT No data
Right 1198290293 X:135233697-135233719 CCCTCCACCATGTCTCTAAATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1198290286 Original CRISPR AGGTGATAGGGATCCCTCAC TGG (reversed) Intergenic