ID: 1198290288

View in Genome Browser
Species Human (GRCh38)
Location X:135233668-135233690
Sequence TTCACACAGAAGGAGGTGAT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1198290288_1198290293 6 Left 1198290288 X:135233668-135233690 CCTATCACCTCCTTCTGTGTGAA No data
Right 1198290293 X:135233697-135233719 CCCTCCACCATGTCTCTAAATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1198290288 Original CRISPR TTCACACAGAAGGAGGTGAT AGG (reversed) Intergenic