ID: 1198290290

View in Genome Browser
Species Human (GRCh38)
Location X:135233678-135233700
Sequence AGGGACTGGCTTCACACAGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1198290290_1198290293 -4 Left 1198290290 X:135233678-135233700 CCTTCTGTGTGAAGCCAGTCCCT No data
Right 1198290293 X:135233697-135233719 CCCTCCACCATGTCTCTAAATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1198290290 Original CRISPR AGGGACTGGCTTCACACAGA AGG (reversed) Intergenic