ID: 1198290293

View in Genome Browser
Species Human (GRCh38)
Location X:135233697-135233719
Sequence CCCTCCACCATGTCTCTAAA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1198290289_1198290293 -1 Left 1198290289 X:135233675-135233697 CCTCCTTCTGTGTGAAGCCAGTC No data
Right 1198290293 X:135233697-135233719 CCCTCCACCATGTCTCTAAATGG No data
1198290285_1198290293 20 Left 1198290285 X:135233654-135233676 CCCAGTGAGGGATCCCTATCACC No data
Right 1198290293 X:135233697-135233719 CCCTCCACCATGTCTCTAAATGG No data
1198290284_1198290293 21 Left 1198290284 X:135233653-135233675 CCCCAGTGAGGGATCCCTATCAC No data
Right 1198290293 X:135233697-135233719 CCCTCCACCATGTCTCTAAATGG No data
1198290288_1198290293 6 Left 1198290288 X:135233668-135233690 CCTATCACCTCCTTCTGTGTGAA No data
Right 1198290293 X:135233697-135233719 CCCTCCACCATGTCTCTAAATGG No data
1198290290_1198290293 -4 Left 1198290290 X:135233678-135233700 CCTTCTGTGTGAAGCCAGTCCCT No data
Right 1198290293 X:135233697-135233719 CCCTCCACCATGTCTCTAAATGG No data
1198290287_1198290293 7 Left 1198290287 X:135233667-135233689 CCCTATCACCTCCTTCTGTGTGA No data
Right 1198290293 X:135233697-135233719 CCCTCCACCATGTCTCTAAATGG No data
1198290286_1198290293 19 Left 1198290286 X:135233655-135233677 CCAGTGAGGGATCCCTATCACCT No data
Right 1198290293 X:135233697-135233719 CCCTCCACCATGTCTCTAAATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1198290293 Original CRISPR CCCTCCACCATGTCTCTAAA TGG Intergenic