ID: 1198291302

View in Genome Browser
Species Human (GRCh38)
Location X:135243399-135243421
Sequence GTCATCATGAGAAAATCACC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1198291302_1198291306 -10 Left 1198291302 X:135243399-135243421 CCAGGTGATTTTCTCATGATGAC No data
Right 1198291306 X:135243412-135243434 TCATGATGACACTGGGGTTACGG No data
1198291302_1198291307 -9 Left 1198291302 X:135243399-135243421 CCAGGTGATTTTCTCATGATGAC No data
Right 1198291307 X:135243413-135243435 CATGATGACACTGGGGTTACGGG No data
1198291302_1198291308 2 Left 1198291302 X:135243399-135243421 CCAGGTGATTTTCTCATGATGAC No data
Right 1198291308 X:135243424-135243446 TGGGGTTACGGGTTTTCGAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1198291302 Original CRISPR GTCATCATGAGAAAATCACC TGG (reversed) Intergenic
No off target data available for this crispr