ID: 1198291541

View in Genome Browser
Species Human (GRCh38)
Location X:135245607-135245629
Sequence GTCTGTCAGGGGAAGGGGAC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1198291541_1198291549 0 Left 1198291541 X:135245607-135245629 CCTGTCCCCTTCCCCTGACAGAC No data
Right 1198291549 X:135245630-135245652 TCACCAAGAGCTGCTTTGCAGGG No data
1198291541_1198291548 -1 Left 1198291541 X:135245607-135245629 CCTGTCCCCTTCCCCTGACAGAC No data
Right 1198291548 X:135245629-135245651 CTCACCAAGAGCTGCTTTGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1198291541 Original CRISPR GTCTGTCAGGGGAAGGGGAC AGG (reversed) Intergenic
No off target data available for this crispr