ID: 1198292724

View in Genome Browser
Species Human (GRCh38)
Location X:135254862-135254884
Sequence GGGCAGCAGGTAGGGCAAGA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 651
Summary {0: 2, 1: 1, 2: 6, 3: 56, 4: 586}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1198292724 Original CRISPR GGGCAGCAGGTAGGGCAAGA AGG Intronic
900087990 1:907819-907841 GGGCAGGAGGGAGGTGAAGAGGG - Intergenic
900311054 1:2033303-2033325 AGGCCGCAGGTGGAGCAAGAGGG + Intergenic
900320651 1:2081831-2081853 GGGCAGCAGGAAGGGGATGCTGG - Intronic
900385494 1:2408731-2408753 GTCCAGCAGGTAGGGCAGGACGG + Exonic
900981415 1:6048233-6048255 GGCCAGCAGGCAGGGCGGGAAGG - Intronic
901154401 1:7125708-7125730 GAGCAGCATGTAGGGTGAGAGGG + Intronic
901322938 1:8350332-8350354 GGGCAGCAGGAAGGGCCCCAGGG + Intergenic
901615062 1:10532376-10532398 GGACAGAAGGTAGGGTCAGAGGG + Intronic
902187124 1:14733880-14733902 GGGCTGCAGATTGGGCAAGGAGG - Intronic
902289002 1:15424635-15424657 GGGCAGGAGGCAGGGCCAGGTGG - Intronic
903554147 1:24180926-24180948 GGGCAGCACGAAGGGCAAGCAGG + Intronic
903996355 1:27307509-27307531 GGGAAGCAGGGAGGGAGAGAGGG - Exonic
904042691 1:27593526-27593548 GGGCAGCACCAAGGGCCAGAGGG - Intronic
904268124 1:29329582-29329604 GGCCAGCAGGTAGAGGATGAGGG + Intergenic
905012933 1:34759387-34759409 GGGCAGGAGAGAGGGCAAGGAGG + Intronic
905422221 1:37855457-37855479 GGGTAGGAGGTGGGACAAGATGG + Intronic
905634481 1:39540458-39540480 GGGCAAAAGGTAGGAGAAGAGGG + Intergenic
907368142 1:53979526-53979548 GGGCGGCAGGCAGGGCACGGTGG + Intergenic
907437426 1:54458754-54458776 GGGCAGGAGGGAGGGAAGGAAGG + Intergenic
909193698 1:72588409-72588431 AGGCAGGAGGAAGGGAAAGAGGG + Intergenic
910124852 1:83829414-83829436 GCGCAGCAGGCAGGACAAAAAGG - Intergenic
911118865 1:94275017-94275039 GAGCAGCATGTAGAGCAAGTGGG + Intronic
911193451 1:94970774-94970796 GGGCAGCTGGTAGAGGAAAAGGG + Intergenic
911276705 1:95869119-95869141 AGGCAGCAGGGAAGGCAAGTGGG + Intergenic
912242504 1:107926370-107926392 GGGTAGGGGGTAGAGCAAGATGG + Intronic
912811849 1:112800960-112800982 GGGGTGCAGATAGGGCAAGGTGG + Intergenic
913168189 1:116208818-116208840 GGGGAGCAGTTAGGTCATGAGGG - Intergenic
913440187 1:118888792-118888814 CTGCAGCAGGAAGTGCAAGATGG + Intronic
915069083 1:153251260-153251282 GGGCATGAGGAAGGGGAAGAGGG - Intergenic
915311815 1:155008921-155008943 GGGCAGCAGGTTGGGACAGGTGG - Intronic
915547473 1:156609258-156609280 AGCCAGCAGGTGGGGCAGGAAGG - Intergenic
915897787 1:159824988-159825010 GGACAGCAGGCAGGGCAGGTTGG - Intergenic
917964301 1:180168854-180168876 GGGCAGCAGGCAGGGCAACAGGG - Intronic
918103708 1:181398541-181398563 GGGCTGGAAGAAGGGCAAGAAGG + Intergenic
920766146 1:208835660-208835682 GGGCAACAGGTAGAGCCTGATGG - Intergenic
921070264 1:211652553-211652575 TGGCAGCAGGCAGGCCAACACGG + Intergenic
922164931 1:223107636-223107658 GAGCAGCAGGTGGGACAGGAGGG + Intergenic
922731467 1:227950605-227950627 AGGCAGCAGGTAGGCCACGGTGG - Intergenic
922968253 1:229710720-229710742 GGGAAGCAGGGAGGGCAAGTCGG + Intergenic
923463963 1:234231930-234231952 GGGCAGGAGGTAGAGGAAGGAGG - Intronic
923482515 1:234397596-234397618 GGGGAGGAGGTGGGGGAAGAGGG + Intronic
923482524 1:234397616-234397638 GGGGAGGAGGTGGGGGAAGAGGG + Intronic
923714170 1:236411026-236411048 GGGCAGTGGGAAGGGAAAGAAGG - Intronic
924516359 1:244769314-244769336 GGGAAGGAGGCAGAGCAAGACGG - Intergenic
924518951 1:244789146-244789168 AGGAAGCAGGAAGGGCAGGAGGG - Intergenic
1063511153 10:6646747-6646769 GGGAAGGAGGGAGGGAAAGAAGG - Intergenic
1063525267 10:6778908-6778930 GGGAAGGAGGGAGGGAAAGAAGG + Intergenic
1064382661 10:14860620-14860642 GAGCAGCAGGGAGGGTAACAGGG + Intronic
1064663921 10:17630952-17630974 GGACAGGAGGGAGGGAAAGAAGG + Intergenic
1064840904 10:19591055-19591077 GGGTGGGAGGTAGGGCAAGGAGG - Intronic
1064870698 10:19933796-19933818 GGGCAGGAGGGAGGGAAAAAAGG + Intronic
1065586790 10:27226580-27226602 GGGCAGCATGTGGCCCAAGACGG + Intronic
1065901822 10:30214866-30214888 GGGCAGCAGGTGGGGCAGCGGGG - Intergenic
1067039160 10:42939897-42939919 GGGCAGGAGGCAGGGCACGTTGG - Intergenic
1068120573 10:52779297-52779319 GGGAAGCAGGGAGGGGAAGAGGG - Intergenic
1068484861 10:57644929-57644951 GGGCAGGAGGAAGAGAAAGAAGG - Intergenic
1068580198 10:58730785-58730807 GGGCTGCAGCTGGGGCAACAGGG + Intronic
1068927759 10:62557721-62557743 GGGGAGCAGATGGGGTAAGAAGG - Intronic
1069321316 10:67175095-67175117 GGGAGGGAGGAAGGGCAAGAAGG + Intronic
1069598208 10:69686505-69686527 GGGCAGCCGGGAGGGCCATATGG - Intronic
1069606428 10:69741667-69741689 GAGCAGCTGATAGGGCAGGAGGG + Intergenic
1069636821 10:69930139-69930161 GGGCAGGAGGTCGGGCAGGAAGG + Intronic
1069917981 10:71798839-71798861 AGGGAGCAGGAAGGCCAAGAAGG + Intronic
1070219166 10:74422753-74422775 GGGGAGCAGGTAGGTAAAGGGGG - Intronic
1071794284 10:88988976-88988998 GGGCAGAGGGTAGGGGAAGGGGG + Intronic
1071910013 10:90221067-90221089 GGGTAGCAAGAAGGGAAAGAGGG - Intergenic
1072290255 10:93958825-93958847 GGACAGCAAGAAGGACAAGAAGG - Intergenic
1072743762 10:97926038-97926060 GGACAGCAGGCAGGGAGAGAGGG - Intronic
1073394468 10:103206747-103206769 GGACAGGCGGTAGGGAAAGAAGG - Intergenic
1073519856 10:104117893-104117915 AGGGAGAAGGTAGGGCAAGTGGG - Intergenic
1073659671 10:105461116-105461138 AGGCTGCAGGTGGGGGAAGATGG - Intergenic
1073768457 10:106709088-106709110 GGGAAGGAGGTAGGGAGAGAGGG - Intronic
1074227057 10:111494763-111494785 GGGAAGGAGGCAGGGAAAGATGG - Intergenic
1074777558 10:116777448-116777470 AGGCACCAGGTGGGGCAGGAAGG - Intergenic
1075077934 10:119363695-119363717 GGGAAGCTGGGAGGGGAAGAAGG + Intronic
1075300076 10:121314458-121314480 GTGCAGCAGGGTGGGCAGGAGGG - Intergenic
1075300099 10:121314577-121314599 GTGCAGTAGGTAGGGTGAGAGGG + Intergenic
1075788758 10:125068531-125068553 GGGCAGCAGGAAGGCCAGGAAGG + Intronic
1075935466 10:126337305-126337327 GGGCAGGAGGAATGGGAAGAAGG + Intronic
1076279057 10:129229959-129229981 GAGCAGCAGGAGAGGCAAGAGGG - Intergenic
1076317797 10:129555155-129555177 GGGCAGCGGGTAGGGCAGGGTGG - Intronic
1076749511 10:132535592-132535614 GGGGAGCAGGGAGGGCACAAGGG + Intergenic
1077366697 11:2164118-2164140 TGGCAGCAGGGAGGGCATGGGGG + Exonic
1077679229 11:4223761-4223783 GGACAGGAGGGAGGGAAAGAAGG + Intergenic
1077688665 11:4320403-4320425 GGACAGGAGGGAGGGAAAGAAGG + Intergenic
1078164630 11:8871288-8871310 GGGCAGCAGGGAGGAGAAGTTGG + Intronic
1078714363 11:13825876-13825898 GGGCAGGACGAAGGGCAGGATGG + Intergenic
1080586905 11:33690849-33690871 GGGAAGCAGTTTGGGGAAGAGGG - Intergenic
1080600934 11:33820092-33820114 GGGCTGCAGGAAGGGGCAGAGGG - Intergenic
1081245627 11:40763377-40763399 GGGCAGGAGGCAGAGCAAGATGG + Intronic
1081532087 11:43968952-43968974 GGGCAGTAGGCAGTGCAGGAAGG - Intergenic
1081806501 11:45893773-45893795 GGGGAGAAGGGAGGGGAAGAAGG - Intronic
1082899313 11:58228387-58228409 GAGCTGCAGGGAGGGGAAGAGGG + Exonic
1084040961 11:66542533-66542555 GGGCAGCAGAAAGAGGAAGATGG + Intronic
1085313865 11:75531622-75531644 GGGCAGCTGGCAGGGCAACATGG + Intergenic
1085329728 11:75637902-75637924 GGGAAGGAGGGAGGGAAAGAAGG + Intronic
1085509977 11:77083267-77083289 GGACAGCAGGGAGGGCAAGGGGG - Intronic
1085562627 11:77486361-77486383 GAGGAGGAGGTGGGGCAAGATGG + Intergenic
1085686994 11:78632345-78632367 GCTCAGGAGGTAGAGCAAGATGG - Intergenic
1085806681 11:79643118-79643140 GGGCAGGAGGGAGGGCTGGAGGG + Intergenic
1086125414 11:83344248-83344270 GGGCAGGTGGGAGGGAAAGAAGG + Intergenic
1087147732 11:94828524-94828546 TGGCAGGAGGTAGGGCCAGAAGG - Intronic
1087782635 11:102317563-102317585 GGGCAGCAGGTGGGCAAGGAAGG + Exonic
1087973225 11:104511746-104511768 GGGAAGGAGGTAGGGAGAGAGGG + Intergenic
1088365595 11:109036938-109036960 GGGAAGGAGGGAGGGAAAGAGGG - Intergenic
1088464224 11:110116142-110116164 GGGCAGGAGTGAAGGCAAGAGGG - Intronic
1088889541 11:114033714-114033736 GTTCAGCAGGTTGGGCATGAGGG - Intergenic
1089024340 11:115253192-115253214 GGGCTGCAGGTTGGACAAGCTGG + Intronic
1089603934 11:119630771-119630793 GGGCAGAAGGAAGGGGAAGGAGG + Intronic
1089968932 11:122676815-122676837 GGTGAGCAGGAAGGGCCAGAAGG - Intronic
1090074764 11:123573107-123573129 GGGGCGCAGGTAGGGCCCGATGG + Intronic
1091634520 12:2187011-2187033 GGGCAGCAGGACAGGCAAGGGGG - Intronic
1091752463 12:3031427-3031449 AGGCAGGAGCTAGTGCAAGAGGG - Intronic
1091775410 12:3181742-3181764 GGGCAGAGGGAAGGGCACGAGGG - Intronic
1091780109 12:3208306-3208328 GGGCAGCTGGGAGGGCCAGGGGG + Intronic
1092137739 12:6161324-6161346 GGGGAACCGGTAGGGGAAGAAGG + Intergenic
1092287400 12:7136749-7136771 GGGCAGGAGGCAGGGAAAGAGGG - Intronic
1092543090 12:9432368-9432390 GGGCTGCAGGGATGGCAAGGCGG + Intergenic
1092591488 12:9955953-9955975 TGACAGCAGTTAAGGCAAGAGGG + Intronic
1092899664 12:13046270-13046292 GGGAAGAAGAAAGGGCAAGAAGG - Intronic
1093608626 12:21126586-21126608 GGGAAGGAGGTTGGGGAAGAGGG + Intronic
1094509929 12:31090070-31090092 GGGCTGCAGGGATGGCAAGGCGG - Exonic
1094608024 12:31966232-31966254 GGGCAGCATGCAGCCCAAGACGG - Intronic
1094825654 12:34267213-34267235 GGGCAGGTGGGAGGGAAAGAAGG - Intergenic
1095379561 12:41573707-41573729 GAGCGGCAGTGAGGGCAAGAAGG + Exonic
1095863562 12:46947141-46947163 GGGCAGGATGTGGGGCAAGAAGG - Intergenic
1095969020 12:47888753-47888775 GGGTAGCAGGGAGGGGAAGATGG + Intronic
1096112375 12:49037259-49037281 GGGCAGCATGGAGGGCAGGCAGG - Exonic
1096630847 12:52925911-52925933 GGGCCCCAGGTAGGGGAGGAAGG + Intronic
1096767025 12:53899477-53899499 GGGAAGCAGGAAGGGAAGGACGG + Intergenic
1097153456 12:56995877-56995899 GGGCAGCAGGAAGCCCAGGATGG - Exonic
1097968232 12:65603828-65603850 GGGAAGGAGGAAGGGAAAGAAGG + Intergenic
1099157653 12:79199384-79199406 AGGCAGCTGGTAGGGAAAAACGG - Intronic
1099583171 12:84479810-84479832 GGGTAGCAGGTAGGGAAGGATGG + Intergenic
1101327960 12:103733080-103733102 GTTCAGCAGGTAGGGCATGGAGG - Exonic
1101328321 12:103736303-103736325 GGGAAGGAGGAAGGGCAAAAGGG + Intronic
1101819134 12:108169701-108169723 TGGCAGCATGTAGGGGAACAGGG + Intronic
1102071089 12:110020484-110020506 GGGCTGCTGCTAGGGCAGGAGGG + Intronic
1103199142 12:119072357-119072379 GGGGAGAAGGTAGGGAAGGAAGG - Intronic
1105273874 13:18903713-18903735 GAGCAGCAGGAATGGCGAGAAGG - Intergenic
1105769919 13:23599525-23599547 GGGGAGCAGGTAGGGGAAGGGGG + Intronic
1106774989 13:33000082-33000104 GGACAGCAGATTGGGCCAGATGG + Intergenic
1107747006 13:43520937-43520959 GGGAAGCAGGGAGGGAATGAGGG + Intronic
1108589647 13:51901793-51901815 GGGCTGGAGGTAGGGAAAGCAGG - Intergenic
1108710576 13:53028736-53028758 GGCCAGCATGTAGGAAAAGAGGG - Intergenic
1108894677 13:55310397-55310419 AGGGAGCAAGTTGGGCAAGATGG - Intergenic
1109108401 13:58284700-58284722 GGGAGGCAGGGAGGGAAAGAAGG + Intergenic
1112569107 13:100577848-100577870 GGGCAGCAGGGAGGGAAGAAGGG + Intronic
1113440351 13:110323581-110323603 AGGTAGCAGGTAGGGGAAGCTGG - Intronic
1114128504 14:19760322-19760344 GGGCAGCTGGAAGGTCAGGAGGG - Intronic
1116534885 14:46016544-46016566 GGACAGGAGGGAGGGAAAGAAGG + Intergenic
1116573350 14:46545513-46545535 GGACAGGAGGGAGGGAAAGAAGG - Intergenic
1116827658 14:49688101-49688123 GGGCAGCTTGAAGGGCGAGAGGG - Intronic
1116985162 14:51210971-51210993 GGGCTGCAGGAAGGGAAAGGAGG + Intergenic
1117348151 14:54854363-54854385 CTGCAGCAGGGAGGGCAGGAAGG + Intronic
1117581496 14:57155988-57156010 GTCCAGCAGGTAGGGCACTATGG + Intergenic
1117633371 14:57716867-57716889 TGGAAGCAGGTAGGGGAATAGGG - Intronic
1117943697 14:60995615-60995637 AGGGAGGAGGAAGGGCAAGAGGG + Intronic
1118785766 14:69044218-69044240 GGGCAGCAGGGAGTGAATGAAGG + Intergenic
1119137979 14:72238277-72238299 GGGGAGCGGGTAGGCCAAAAAGG + Intronic
1119144118 14:72294697-72294719 GGGCAGGAGGGAGGGAGAGAGGG + Intronic
1119322153 14:73738703-73738725 GGGCAGCGAGGAGGGCATGAGGG - Exonic
1119481332 14:74960178-74960200 GCCCAGGAGGCAGGGCAAGAAGG - Intergenic
1120107895 14:80517027-80517049 GGGGAGGAGGCAGAGCAAGATGG - Intronic
1120149911 14:81021513-81021535 GGACAGTAGGCAGGGAAAGAAGG + Intronic
1120717577 14:87856085-87856107 GGGAAGGAGGGAGGGAAAGAGGG + Intronic
1120927362 14:89811038-89811060 GGGCAGCAGGTCAGGGAAGCAGG + Intronic
1121635861 14:95453452-95453474 AGGCAGCAGCTGGGGCAATAGGG + Intronic
1122031249 14:98914234-98914256 AGGAAGCAGGGAGGGAAAGAGGG + Intergenic
1122470378 14:101962180-101962202 GGGCAGGGGGCAGGGCAAGCTGG - Intergenic
1122930744 14:104932110-104932132 GGACCGCAGGTAGGGGAACATGG - Exonic
1123571445 15:21614590-21614612 GGGCAGCTGGAAGGTCAGGACGG - Intergenic
1123608063 15:22057181-22057203 GGGCAGCTGGAAGGTCAGGAGGG - Intergenic
1124413117 15:29452862-29452884 GGGCAGGAGGAAGAGAAAGAAGG + Intronic
1124649941 15:31467092-31467114 GGGCAGTGGGAAGGGCAGGAGGG + Intergenic
1125045669 15:35240356-35240378 GGACAGGAGGGAGGGAAAGAAGG - Intronic
1125131621 15:36289781-36289803 GGACAGGCGGTAGGGAAAGAAGG + Intergenic
1125501402 15:40242084-40242106 GGGCAGCAGGTTGGGCCAGGAGG + Intronic
1127068735 15:55267437-55267459 GGGGGGCAGGTAGGGGAAGTGGG - Intronic
1128238146 15:66081263-66081285 GGGCAGCAGGGAGGTCACCAGGG + Intronic
1129249534 15:74301239-74301261 GGGGAGCAGGTAAGGCGAGGGGG + Intronic
1130014192 15:80174697-80174719 GGGCAGCAGACAGGCCGAGATGG - Intronic
1130327870 15:82896080-82896102 GGGCTGGAGGTGGGGCAACAGGG + Intronic
1130379721 15:83360986-83361008 GGGCAGCAGGAGAGGGAAGAAGG - Intergenic
1130439867 15:83942780-83942802 TGGCAGCAGGTAGGGCAGACTGG + Exonic
1130939639 15:88497001-88497023 AGTCAGCAGGTGGGGGAAGATGG - Intergenic
1130959920 15:88652602-88652624 GGGGAGGAGGAAGGGGAAGAAGG - Intronic
1131264351 15:90906788-90906810 GCGCAGCAGGTAAGGCATGGTGG - Exonic
1131672477 15:94634057-94634079 GGACAGCAGTCAGGGCAAGAGGG - Intergenic
1131725916 15:95224490-95224512 GGACAGAGGGTAGAGCAAGATGG - Intergenic
1131764471 15:95660438-95660460 GGGCAGGAGGGAGGGCAGGGGGG - Intergenic
1132183547 15:99781973-99781995 GGGCAGCAAGAAGGGAAACAGGG + Intergenic
1132434833 15:101791196-101791218 GGGCAGCAAGAAGGGAAACAGGG - Intergenic
1202980298 15_KI270727v1_random:348979-349001 GGGCAGCTGGAAGGTCAGGAGGG - Intergenic
1132578447 16:674572-674594 GGGAAGCAGGATGGGCCAGAGGG + Intronic
1132601058 16:773168-773190 GGGCAGCAGGTGCTGCAACAGGG + Exonic
1133404774 16:5514740-5514762 GGGAAGGAGGAAGGGGAAGAGGG + Intergenic
1133436499 16:5784612-5784634 GGGCTGGAGGTGGGGCCAGATGG - Intergenic
1133450897 16:5903293-5903315 GCACAGCAGGGAGGGCAAGAGGG - Intergenic
1133707633 16:8370275-8370297 GGGCAGTAGGTAGGTCATGAGGG - Intergenic
1134043821 16:11087210-11087232 GGGCAGCAGGTGGGGGATGGGGG - Intronic
1134682672 16:16137299-16137321 TGGCCTCAGGTGGGGCAAGAAGG + Intronic
1135640991 16:24119599-24119621 GGGCAGCAGGGAGGGGAGTAGGG + Intronic
1136050490 16:27646643-27646665 GTGCAGCAATCAGGGCAAGAAGG + Intronic
1136105182 16:28025285-28025307 GGCCAGCAGCTAGGGCCAGGAGG + Intronic
1136281021 16:29211440-29211462 GGGGAGCAGGGTGGGGAAGAGGG - Intergenic
1137314351 16:47300447-47300469 GGGCAGCAGGTAAGGAAAGAAGG + Intronic
1137675456 16:50301733-50301755 GGGCAGCAGACAGGCCAAGGCGG - Intronic
1137924769 16:52530125-52530147 GGGCAGCAGGGACTTCAAGAAGG + Intronic
1138146693 16:54619058-54619080 GGGCAGAAGGCAGGGAATGACGG + Intergenic
1138455328 16:57117546-57117568 GGGCAGGAGGCTGGACAAGAAGG + Exonic
1138834753 16:60420886-60420908 GGGCACCAGGCCGGGCAAAAGGG - Intergenic
1139485269 16:67252671-67252693 AGGCAGCAGGAAGAGGAAGAAGG - Exonic
1140406273 16:74713609-74713631 AGGCAGCTGGCAGGGCCAGAGGG + Exonic
1140728657 16:77836509-77836531 GGTCAGCAGTTAGGGAAAGAGGG - Intronic
1140746311 16:77983332-77983354 GGGCAGGAGGTAGGGGAAGTAGG + Intergenic
1141054443 16:80803516-80803538 GGGCAGCAGGTGGGGGGTGAGGG + Intronic
1141992459 16:87618328-87618350 GGGCAGCAGCTGGGGGAGGAGGG + Intronic
1142032393 16:87845046-87845068 GGGCAGCTGGAAGGGGAAGGTGG + Intronic
1142085379 16:88177363-88177385 GGGGAGCAGGGTGGGGAAGAGGG - Intergenic
1142137817 16:88459710-88459732 GGGGAGGAGGAAGGGGAAGAGGG - Intronic
1142809211 17:2387395-2387417 GGGCAGCCGGTGGGGGAGGAGGG + Exonic
1143051916 17:4132976-4132998 GTGGAGCAGGTGGGGGAAGAAGG + Intronic
1143093564 17:4464306-4464328 GGGCAGCAGCTCTGGGAAGAAGG - Intronic
1143157922 17:4850499-4850521 GGCCAGCAGGAAGGGGAGGAAGG - Intronic
1143237988 17:5419647-5419669 GGGGAGCAGTTGGGCCAAGATGG - Exonic
1143831544 17:9655959-9655981 GGAGAGCAAGTAGGGCTAGAAGG + Intronic
1143869773 17:9949825-9949847 GGGAAGGAGGGAGGGGAAGAGGG - Intronic
1143996851 17:11013892-11013914 GGGCAGCAGATAGAGCAAACAGG - Intergenic
1144155499 17:12496594-12496616 AGGCAGCAGGGAGGTCTAGATGG - Intergenic
1144329323 17:14210186-14210208 GGGTAGTAGGTGTGGCAAGAAGG - Intergenic
1144604517 17:16653337-16653359 GGAGAGCAGTTAGGGAAAGAAGG - Intronic
1144646874 17:16981111-16981133 GGGCAGCAGCAGGGGCAAGGCGG - Intergenic
1145768903 17:27478653-27478675 GGGGTGCAGGAAGGGCAAGGAGG - Intronic
1146625926 17:34435338-34435360 AGGGAGCAGGAAGGGCAAGGGGG - Intergenic
1147054302 17:37822619-37822641 GGAAAGAAGGAAGGGCAAGAGGG - Intergenic
1147658684 17:42105500-42105522 GGGCAGAAGGTTGGGCATGGGGG - Intronic
1147677710 17:42219274-42219296 GGCCAGCGGGCAGGGCAGGAGGG - Intronic
1147679009 17:42227575-42227597 GAGCACCAGGTGGGGGAAGATGG - Exonic
1147686654 17:42289954-42289976 GAGCACCAGGTGGGGGAAGATGG + Exonic
1147688326 17:42300297-42300319 GGCCAGCGGGCAGGGCAGGAGGG + Intronic
1148071288 17:44910377-44910399 GGGGTGCAGGGAGGGGAAGAGGG + Exonic
1148114137 17:45165007-45165029 AGGCAGCAGGTAGGGCTAGGGGG + Intronic
1148438326 17:47698895-47698917 GGACAGCAGGTAAGGGAGGATGG - Intronic
1149618947 17:58027071-58027093 GGGCAGGAGGTGGGGAGAGAAGG + Intergenic
1149868211 17:60162134-60162156 GGGCCGCAGGGAGGGCAGGCAGG - Intronic
1150461878 17:65360536-65360558 GGTCAGCAGGCAGGGGGAGAAGG + Intergenic
1151273309 17:73013610-73013632 GGGCAGCAGGTGGCCCAGGACGG + Intronic
1153099493 18:1450669-1450691 GGAGAGGAGGTGGGGCAAGATGG + Intergenic
1153262260 18:3236020-3236042 GGGCAGGAAGTAGGAGAAGAGGG + Intergenic
1154173768 18:12068403-12068425 GAGCAGCACGTACGCCAAGAGGG - Intergenic
1154948393 18:21184576-21184598 GGGGAACAGGTTGGGCAGGAAGG + Intergenic
1157371027 18:47112089-47112111 GGGCAGCATGCAGGGGAAGAAGG + Intronic
1157583594 18:48787369-48787391 GGGCAGGAGGAAGGGAGAGAAGG + Intronic
1157780122 18:50430862-50430884 GGGAGGCAGGCAGGGCCAGAGGG + Intergenic
1159268061 18:66110849-66110871 GGGAAGAAGGGAGGGAAAGAAGG - Intergenic
1160495519 18:79372192-79372214 GGGCAGGAGGCAGGGGACGAGGG - Intronic
1160495528 18:79372214-79372236 GGGCAGGAGGCAGGGGACGAGGG - Intronic
1160495537 18:79372236-79372258 GGGCAGGAGGCAGGGGACGAGGG - Intronic
1160616194 18:80131090-80131112 TGGCAGCAGGTAGGGAAGGGAGG - Intronic
1160760542 19:782066-782088 GGACAGCAGGGAGGGAGAGACGG - Intergenic
1161375694 19:3938023-3938045 GGGGAGCAGGTATTGCAGGAGGG - Intronic
1161375711 19:3938069-3938091 GGGGAGCAGGTATTGCAGGAGGG - Intronic
1161375726 19:3938115-3938137 GGGGAGCAGGTATTGCAGGAGGG - Intronic
1161375758 19:3938207-3938229 GGGGAGCAGGTATTGCAGGAGGG - Intronic
1161375809 19:3938344-3938366 GGGGAGCAGGTATTGCAGGAGGG - Intronic
1161375841 19:3938435-3938457 GGGGAGCAGGTATTGCAGGAGGG - Intronic
1161701651 19:5799264-5799286 GGGCTGCGGAGAGGGCAAGAGGG - Intergenic
1162927635 19:13938199-13938221 GGTCAGCAGCTTGGGCGAGATGG - Exonic
1162939129 19:13997556-13997578 AGGCAGCAGGCAGGGCCAGAAGG - Intronic
1162968652 19:14167481-14167503 GGGCAGCAGGCAGGGTGGGAAGG - Intronic
1163312483 19:16522569-16522591 GGGCAAGAGGTGAGGCAAGAAGG - Intronic
1163827856 19:19533585-19533607 GGGGAGGAGGTAGGGTAAGTGGG - Intronic
1164037363 19:21466654-21466676 GGGCGGCAGGTGGGGCAAGGAGG + Intronic
1164503464 19:28839074-28839096 GGGCAGCATGGAGGGACAGACGG - Intergenic
1164538223 19:29102756-29102778 GAGCAGCAGGAAGGGAGAGATGG - Intergenic
1164877410 19:31701181-31701203 TGGAGGCAGGTAGGGCAGGAAGG + Intergenic
1165397154 19:35570716-35570738 GGGCAGCAGGAAGGGTGGGATGG + Intergenic
1165577938 19:36837755-36837777 GAGCAGCAGGTTGGGGTAGAGGG - Intronic
1165793530 19:38506048-38506070 GGGAGGTAGGTGGGGCAAGAGGG + Intronic
1166304905 19:41932208-41932230 GGGCAGCGGGGAGGGCAGGGTGG - Intergenic
1166335314 19:42102658-42102680 GGGGATGAGGTAGGGAAAGAGGG + Intronic
1167845407 19:52159760-52159782 AGGGAGGAGGAAGGGCAAGAGGG + Intronic
1168076979 19:53985980-53986002 AGGCAGGAGGAAGAGCAAGATGG + Exonic
1168406633 19:56114067-56114089 TGGCAGCAGTTTGGGCAAGGAGG - Intronic
1168519798 19:57040302-57040324 GGGCACCAGGTAGGCCAGGTTGG - Intergenic
925004323 2:429285-429307 GAGCAGGAGGAAGAGCAAGAAGG - Intergenic
925266860 2:2571722-2571744 GGGCAGCAGGAAGGGGAAGCCGG - Intergenic
926533435 2:14081809-14081831 AGGCAGCAGGGTGGGCAAGATGG + Intergenic
926809859 2:16746547-16746569 GGGCAGGAGGGAGGGAAGGATGG - Intergenic
926843523 2:17108075-17108097 GGACAGCAGCAAGGGCAAGAAGG + Intergenic
926908085 2:17824642-17824664 GGGGAGCAGAGAGGGGAAGAAGG - Intergenic
927468832 2:23357113-23357135 GGGCAGCAAGGAGAGCAAGGTGG + Intergenic
927497782 2:23562366-23562388 GGGCAGCCGGGAGGGCACCACGG - Exonic
928402279 2:30987731-30987753 AGGCAGCAGGTGGGGGAGGAGGG - Intronic
928779785 2:34805015-34805037 GGACAGGAGGGAGGGAAAGAAGG + Intergenic
929099846 2:38301307-38301329 GGGAAGGAGGCAGAGCAAGATGG + Intronic
929372973 2:41249633-41249655 GGGAAGGAGGGAGGGAAAGAAGG + Intergenic
929484525 2:42342012-42342034 GGGCAGGTGGGAGGGGAAGATGG + Intronic
930034945 2:47079438-47079460 GGGCAGCAGGGGGGGCCAGGGGG + Intronic
930954993 2:57194556-57194578 GGACAGGCGGTAGGGAAAGAAGG - Intergenic
931059956 2:58516440-58516462 CTACAGCAGGTTGGGCAAGAGGG - Intergenic
931779390 2:65566236-65566258 GGGCAGTAGACAGGGCATGAAGG + Intergenic
931850318 2:66245516-66245538 GGACAGCCGGGAGGGAAAGAAGG - Intergenic
931918451 2:66985478-66985500 AGGCAGCAAGTATGGCAAGAGGG + Intergenic
932169079 2:69537385-69537407 AGGCAGTAGGGAGGGCAAGGGGG + Intronic
932567529 2:72918858-72918880 GGGCAGCAGGGAGGGCGAATCGG + Intronic
932573134 2:72948707-72948729 GGGCAGCAGGTAGGAGCAGGGGG + Intronic
933079169 2:77966696-77966718 GGACAGGAGGGAGGGAAAGAAGG - Intergenic
933148740 2:78889279-78889301 GGTCAGCAGGAAAGGCAAGGTGG - Intergenic
933227581 2:79768504-79768526 GGGGAGGAGGCAGAGCAAGATGG - Intronic
933329625 2:80878587-80878609 GGACAGGAGGGAGGGAAAGAAGG + Intergenic
934674624 2:96240939-96240961 GGCCAGCAGGCAAGGCAAGAGGG + Intergenic
934973626 2:98784913-98784935 GGGCAGCAGAGATGGAAAGAAGG - Intergenic
935019068 2:99213249-99213271 TGGGAGGAGGCAGGGCAAGATGG - Intronic
935131524 2:100264663-100264685 GGGAAGAAGGAAGGGAAAGATGG - Intergenic
937495340 2:122413409-122413431 GGCTAGGTGGTAGGGCAAGAAGG - Intergenic
937863167 2:126729387-126729409 GGACAGCAGGCTGGGAAAGAAGG + Intergenic
937906067 2:127053450-127053472 GCGCAGCAGTGAGGGCGAGAAGG + Intronic
937976055 2:127582676-127582698 GGACAGCAGGTGGCCCAAGAAGG - Intronic
938068144 2:128292795-128292817 GGGCAGCAGGAAGGGCAGGCAGG + Intronic
938256211 2:129861826-129861848 TGGCTGCAGGGAGGGCAGGATGG - Intergenic
938737290 2:134197859-134197881 GGGTAGGAGGAAGGGCAAGGAGG + Intronic
938775752 2:134540008-134540030 GGGCAGCAGGGAGCAGAAGATGG + Intronic
939999733 2:148955086-148955108 GGGAAGGAGGGAGGGCAGGAGGG - Intronic
940398170 2:153217705-153217727 GGGAAACATGTAGGGTAAGAAGG - Intergenic
941202166 2:162525441-162525463 GGGCAGAAGACAGGACAAGATGG + Intronic
941965057 2:171292621-171292643 AGGCAGGTGATAGGGCAAGATGG + Intergenic
943379849 2:187131281-187131303 GGGCTGGAGGTGGGGGAAGACGG + Intergenic
943898297 2:193397655-193397677 GGGAAGAAGTTAGGGTAAGATGG - Intergenic
944676095 2:202034841-202034863 GCCCAGCAGGTTGGGCAGGATGG - Exonic
944920895 2:204412182-204412204 TGGCAGAAGGCAAGGCAAGAAGG - Intergenic
946305783 2:218856252-218856274 GGGAAGTAGGGAGGGAAAGAGGG + Intergenic
946313275 2:218894639-218894661 GGGGAGCAGGTGGGGCCAGGAGG + Intronic
946398222 2:219454067-219454089 GGGCAGCATGAAGAGCAAGAGGG - Intronic
946511244 2:220358854-220358876 GGACAGAAGGAAGGGAAAGAAGG - Intergenic
947523621 2:230865824-230865846 GGGGAGCAGGGAGGCCCAGACGG - Intronic
947636634 2:231683643-231683665 CTGCAGCAGGAAGGGCAGGAGGG + Intergenic
948067862 2:235094977-235094999 GCGCTGTAGGTAGGGCAAGGTGG + Intergenic
948209586 2:236182996-236183018 GAGAAGCAGGGAGGGAAAGAAGG - Intergenic
948545579 2:238726273-238726295 GGGCAAGAGGGTGGGCAAGACGG + Intergenic
948734648 2:239993891-239993913 CGGCAGGAGGGAAGGCAAGATGG + Intronic
948748061 2:240110072-240110094 GGGCTGGAGGGAGGGCAGGAGGG + Intergenic
948884121 2:240874485-240874507 GGGCAGGGGGTAGGGGAAGGGGG + Intronic
948940040 2:241190956-241190978 GAGCGGCAGGCAGGGCCAGAGGG - Intronic
1168830397 20:842282-842304 GGCCAGCAGATGGGGCCAGAGGG + Intronic
1168866736 20:1092991-1093013 GGGCTGCTGTTAGGGCAGGAAGG + Intergenic
1169194414 20:3675496-3675518 GGGCAGCAGGCAGGGGAACTGGG - Intronic
1169397427 20:5245154-5245176 GGGGAGCAGGTGGGGGAAGAGGG - Intergenic
1169693313 20:8358119-8358141 GGGCAAAAGTCAGGGCAAGATGG - Intronic
1169845964 20:9991515-9991537 TGTGAGCAGGTAGTGCAAGAGGG - Intronic
1170522088 20:17197175-17197197 GGGAAGGAGGGAGGGCAGGAGGG + Intergenic
1170820810 20:19755250-19755272 GGACAGGAGGGAGGGAAAGAAGG + Intergenic
1171034403 20:21704309-21704331 GGGCAGGAGGGAGGGGAAGAGGG + Intergenic
1171042316 20:21776834-21776856 GGTCAGCAGGAAGGGCTAGCTGG - Intergenic
1171216532 20:23356463-23356485 GTTCGGCAGGTAGGGCCAGATGG + Intergenic
1172539341 20:35699094-35699116 GGGCAGCAGGGTGGACAGGAAGG + Intronic
1172772536 20:37389875-37389897 GGGCAGCAAGCAGGGAAGGAAGG - Intronic
1172931679 20:38591057-38591079 CCTCAGCAGGTGGGGCAAGAGGG - Intergenic
1172968469 20:38856176-38856198 GGGAAGTAGCTGGGGCAAGAGGG + Intronic
1173101803 20:40094930-40094952 GGACAGGAGGGAGGGAAAGAAGG - Intergenic
1173103670 20:40111010-40111032 GGGCAGCAGGTAGGGAGTGAGGG + Intergenic
1173118764 20:40270646-40270668 GGACAGGAGGGAGGGAAAGAAGG - Intergenic
1173495606 20:43515181-43515203 GGGCTGAAGGTAGAGCAAGTAGG - Intronic
1174059818 20:47825108-47825130 CAGCAGCTGGCAGGGCAAGAGGG + Intergenic
1174150121 20:48480529-48480551 GGGTAGCAGAGAGGGCAAGACGG - Intergenic
1174568450 20:51484092-51484114 GGGCAGCAGGGAGGGAAGAAGGG - Intronic
1175168511 20:57063209-57063231 TGGCAGCAGGTAGGCCATGGGGG + Intergenic
1175965686 20:62658967-62658989 GGGCAGGAGGCAGGGCAGGCAGG + Intronic
1176183609 20:63765993-63766015 GGGCAGCAGGTGGGCCCAGCGGG - Intronic
1177247233 21:18543564-18543586 TGGCAGCAGGTGAGACAAGATGG - Intergenic
1177262517 21:18749299-18749321 GAGCAGCAGGAAGGCAAAGAGGG + Intergenic
1178102381 21:29283680-29283702 GAGCAGGAGGAAGGGAAAGAAGG + Intronic
1178604580 21:34024768-34024790 GGGAAGTAGGTAAGGCCAGATGG + Intergenic
1178730178 21:35094817-35094839 GGGCAGAGGGTGGGGGAAGAAGG - Intronic
1178765213 21:35444150-35444172 GGTCAGCAGACAGGGCAAGTGGG - Intronic
1179674563 21:42973307-42973329 AAGCAGCAGGGTGGGCAAGAGGG - Intergenic
1179929162 21:44555788-44555810 GGGGAGCAGGCATGGCAGGAAGG - Intronic
1179984730 21:44914045-44914067 GGGCAGCAGGGAGGGCCTCAGGG - Intronic
1180941452 22:19662046-19662068 GGGCAGCAGGCAGGGGTGGAAGG - Intergenic
1180949764 22:19715708-19715730 GTGCAGCAGGCAGGGCAGGAGGG + Intronic
1180957066 22:19745921-19745943 GGGCAGCAGGAGGGAAAAGAGGG - Intergenic
1181599589 22:23941616-23941638 GGGAAACAGGCAGGGCCAGAAGG - Intergenic
1181608918 22:23999690-23999712 GGGAAACAGGCAGGGCCAGAAGG + Intergenic
1181688174 22:24543441-24543463 GGGCAGTAGGCAGGCCAGGATGG + Intronic
1182076572 22:27499287-27499309 GGGCAGCAGGTGGCGGAACAGGG - Intergenic
1183119349 22:35718259-35718281 AGGCAGCAGGCAGGACAAGGTGG + Intronic
1183245647 22:36691297-36691319 GGGCAGAAGGCAGGGGGAGAGGG + Intronic
1183629701 22:39025749-39025771 GGGCAGGACGGAGGGCAGGAGGG - Intronic
1183633152 22:39045620-39045642 GGGCAGGACGGAGGGCAGGAGGG - Intronic
1183638907 22:39081687-39081709 GGGCAGGAGGGAAGGCAGGAGGG - Intronic
1183698841 22:39438286-39438308 GGGAAGGAGGGAGGGAAAGAAGG - Intergenic
1183730866 22:39617739-39617761 GGGCAGCAGCTAGGCAGAGAGGG - Intronic
1184331183 22:43828951-43828973 GGAGAGCAGGGAGGGCAACAGGG + Intronic
1184799900 22:46752971-46752993 GGGCAGGGGGCAGGGCTAGAGGG - Intergenic
1185123875 22:48993144-48993166 GGGGAGGAGGGAGGGGAAGAAGG - Intergenic
949197679 3:1332581-1332603 AGGAAGCAGGAAGGGCAAGAAGG + Intronic
950634200 3:14303573-14303595 GGGCAGCAAGTAGGTCAATGTGG - Intergenic
950956412 3:17058128-17058150 GGGCAGGAGTTAAGTCAAGAAGG + Intronic
951053968 3:18126206-18126228 GGGAAGGAGGGAGGGAAAGAGGG - Intronic
951829581 3:26911100-26911122 GGAAAGAAGGGAGGGCAAGAGGG - Intergenic
952792868 3:37214238-37214260 GGGAAACAGGATGGGCAAGAGGG + Intergenic
952886720 3:38016874-38016896 GGGCAGGAGGTTGGACAAGTGGG + Intronic
952952909 3:38538899-38538921 AGGCTGCAGGCAGGGCAGGAGGG - Intronic
953507319 3:43498783-43498805 TTTCAGCAGGTAGGGTAAGAGGG + Intronic
954297623 3:49682957-49682979 GGGCAGCACACAGGGCAAGGAGG - Intronic
954301820 3:49704343-49704365 GACCAGCAGGAAGGGCATGATGG + Intronic
955491488 3:59487663-59487685 AGGCAGGAGGTAAGGAAAGATGG - Intergenic
955660400 3:61292765-61292787 AGGCCTCAGGAAGGGCAAGAAGG - Intergenic
956060409 3:65342922-65342944 GGGCAGTAAGAAGGGAAAGAGGG + Intergenic
957060002 3:75474181-75474203 GGGCAGCTGGGAGGGAAAGAAGG + Intergenic
957675361 3:83357265-83357287 GGGCAGGTGGGAGGGAAAGAAGG + Intergenic
957810620 3:85216147-85216169 GGGAAGGAGGTTGAGCAAGATGG - Intronic
958078215 3:88711779-88711801 GAGGAGCAGGTGGAGCAAGATGG + Intergenic
958095465 3:88938769-88938791 GGGCAGCAGTGAGTGCAAGCAGG + Intergenic
958179591 3:90042820-90042842 AGGCAGCAGGGAGGGATAGAAGG + Intergenic
959485878 3:106926852-106926874 GGACAGGAGGGAGGGAAAGAAGG + Intergenic
961633641 3:128319246-128319268 AGGCAGCAGGCAGGGTAAGCTGG - Intronic
961681101 3:128600742-128600764 GGGCAGCAGGTAGAGGAGGGTGG - Intergenic
961833589 3:129638534-129638556 GGGCAGGAGGGAAGGCGAGAAGG - Intergenic
962008189 3:131369142-131369164 GAGCAGAAGGTAGGACAAGCTGG + Intergenic
962684516 3:137834182-137834204 GGGCACCAGGAAGGGAAGGAGGG + Intergenic
962750705 3:138433069-138433091 GGTCAGCAGGGAGGGCCACAAGG + Intergenic
963111958 3:141695433-141695455 GGACAGGAGGGAGGGAAAGAAGG + Intergenic
964731522 3:159871876-159871898 GGGCAGATAGCAGGGCAAGAGGG + Intronic
965624990 3:170676666-170676688 GGACAGGAGGGAGGGAAAGAAGG + Intronic
966144488 3:176794283-176794305 GGGCAGTGGGAAGGGCAGGAAGG + Intergenic
966441439 3:179949650-179949672 AGGCAGCAGCTGGGGCAAGAAGG - Intronic
966974637 3:185073261-185073283 GGGCAACAGGATAGGCAAGATGG + Intergenic
967737955 3:192973266-192973288 GGGCAGGAGGCAGAGGAAGATGG + Intergenic
968082581 3:195856910-195856932 GGGCGGCTGGCAGGCCAAGAAGG + Intergenic
968297391 3:197587270-197587292 TGGCAGCAGAAAGGTCAAGAGGG - Intergenic
968599423 4:1502044-1502066 GGGCAGCAGGTGGGGGAACAGGG - Intergenic
968673391 4:1864230-1864252 GAGCCGCAGCTAGGGCCAGAAGG - Intergenic
968752828 4:2399096-2399118 GGGCACAAGCTGGGGCAAGATGG + Intronic
969452366 4:7281918-7281940 AGGCAGCTGGGAGTGCAAGATGG - Intronic
969725368 4:8915283-8915305 GGGCAGCAAGGAGGGCACCATGG - Intergenic
970654308 4:18214093-18214115 GGGCAGAAGGGAGGGGAAAAAGG + Intergenic
971034197 4:22675404-22675426 GGGAAGCAGGGAGGGAAGGAAGG - Intergenic
971200026 4:24502595-24502617 GGACAGGAGGGAGGGAAAGAAGG - Intergenic
971343419 4:25790782-25790804 GGGAAGGAGGGAGGGAAAGAAGG + Intronic
972413209 4:38813670-38813692 GGGCAGTAGGGAGGAAAAGAGGG - Intronic
972610325 4:40650309-40650331 GTGCAGCAGGGAGTGGAAGAAGG - Intergenic
974025822 4:56732370-56732392 GGGCAGCAGGAATGGATAGAGGG - Intergenic
974309516 4:60187094-60187116 GGGGAGGAGGTGGAGCAAGAAGG + Intergenic
974428504 4:61768415-61768437 GGACAGGAGGGAGGGAAAGAAGG + Intronic
975561874 4:75716137-75716159 GGGCAGTGGGAAGGGCAAGTTGG + Intronic
975961173 4:79907404-79907426 GGGAAGCAGGAAGACCAAGAAGG - Intronic
978797555 4:112723368-112723390 GGGAAGCAGGGTGGGCAGGACGG + Intergenic
980078613 4:128320500-128320522 GGGAAGCAGGGAGGGAAGGAAGG - Intergenic
980657677 4:135811354-135811376 AGGAAGGATGTAGGGCAAGATGG + Intergenic
980903822 4:138929443-138929465 GGGCAGGTGGGAGGGAAAGAAGG - Intergenic
981300833 4:143184787-143184809 GGGGAGCAGGGAGGGAGAGAGGG + Intergenic
982152117 4:152471471-152471493 GGGAAGCAGGGAGGGAAAGGGGG + Intronic
982401694 4:154975088-154975110 GGGCAACAGCAAGGCCAAGATGG - Intergenic
982605111 4:157505953-157505975 GGGAAGCAGCTAGGTCATGAAGG - Intergenic
983397728 4:167222283-167222305 GGGCTGCAGGAAGGGCAAAATGG + Intronic
984706851 4:182853570-182853592 GGGGACCAGATGGGGCAAGAGGG - Intergenic
984734367 4:183097495-183097517 GGGCCGGAGGTAGGGAAGGAAGG - Intergenic
985614383 5:910780-910802 GGGCTGCAGGAAGGGCCAGAGGG - Intronic
985631635 5:1017157-1017179 GGGCAGCAGGGAGGCCACCAGGG - Intronic
985765650 5:1778101-1778123 GGGCAGCAGGTATGGACAGCAGG - Intergenic
988453126 5:31363136-31363158 GGGCAGCAGGAAGTGGAAAAGGG + Intergenic
991599955 5:68342330-68342352 GGGGAACAGCTAGTGCAAGAAGG + Intergenic
992596347 5:78351328-78351350 GAGCAGGAGGCAGAGCAAGAAGG - Intergenic
992778518 5:80108136-80108158 AAGCAGCCAGTAGGGCAAGAGGG + Intergenic
993671217 5:90764017-90764039 GGGCTGCAGGGAGGGAAGGATGG + Intronic
995160330 5:108972360-108972382 GAGCTGCAGGTAGGGACAGAGGG - Intronic
995579126 5:113575537-113575559 GTGCTGCAGGTAGAGAAAGAGGG + Intronic
997513710 5:134470229-134470251 GGGCTGCAGGTGGGGCGTGAGGG - Intergenic
998377518 5:141701220-141701242 GGGCAGAAGGTAGGGAGAAATGG - Intergenic
998490098 5:142539430-142539452 GGGAAGCAGGAAGGGGAGGAGGG - Intergenic
998490125 5:142539498-142539520 GGGAAGCAGGGAGGGAAGGAGGG - Intergenic
999406757 5:151313327-151313349 AGGGAGGAGGTAGAGCAAGATGG - Intergenic
1000284856 5:159818337-159818359 GGGCAGGAGGTAGAACCAGATGG - Intergenic
1001083958 5:168686965-168686987 GGGCTTCAGGTAAGGCAGGAGGG - Exonic
1001708322 5:173758168-173758190 GGGCAGAAGGTGGGGCCAGTTGG - Intergenic
1001710209 5:173772392-173772414 GGGCAGAAAGGAGGGCAGGAAGG - Intergenic
1002024253 5:176386017-176386039 GGGCTGGAGGTAGAGGAAGATGG + Intronic
1002069836 5:176672618-176672640 GGGCAGCAGGGATGGGAAGGAGG + Intergenic
1002175328 5:177398244-177398266 GGTGAGCAGGCAGTGCAAGACGG - Exonic
1002806752 6:583867-583889 GAGCTGCAGGGAGGGCAAGATGG + Intronic
1003311547 6:4973733-4973755 GGACCGAAGGGAGGGCAAGATGG - Intergenic
1003807207 6:9738425-9738447 GGGCAGGAAGCAGGGTAAGAAGG + Intronic
1004324470 6:14662263-14662285 GGACAGCTGGCAGTGCAAGATGG + Intergenic
1004466168 6:15887275-15887297 GGGTAGAAGGTGGGGAAAGAGGG + Intergenic
1004541051 6:16550245-16550267 GTGCAGGAGGGAAGGCAAGAGGG - Intronic
1004626887 6:17385166-17385188 GGGAAGGAGGGAGGGCAGGATGG + Intergenic
1005320284 6:24646402-24646424 GGAAAGCAGGTAGGGTATGAAGG - Intergenic
1005397418 6:25397411-25397433 TGGCAGCAAGTAGAGCATGAGGG + Intronic
1005816100 6:29553982-29554004 GGGCTGCAGGTAGGTGTAGATGG - Intergenic
1006034806 6:31202822-31202844 GGGCAGAAGGTGCGGCAGGAAGG - Exonic
1006085666 6:31593162-31593184 GAGCAGCAGGGAGGGTAAGTAGG - Intergenic
1006463273 6:34176480-34176502 GGGCCCCAGAGAGGGCAAGATGG - Intergenic
1006550567 6:34819680-34819702 TTGCAGCAGTTAGGGGAAGAAGG + Intronic
1006877928 6:37314755-37314777 GGGCAGCAGGTAAGGGAGAAAGG - Intronic
1006926419 6:37658007-37658029 GGTGAGCAGGGAGGGCAGGATGG - Intronic
1007230107 6:40342356-40342378 GGGCAGCAGGAAGGGGAGGTGGG - Intergenic
1007336212 6:41156978-41157000 GGGCAGGAGGTAGGTGGAGAAGG + Intergenic
1007375091 6:41451132-41451154 GGGCAGCAGGCAGGGAAGCAGGG + Intergenic
1007699735 6:43759618-43759640 GGGCAGCAGGTAAGGCTCTAGGG - Intergenic
1007725652 6:43914273-43914295 GGGGTGCAGGTAGGGGTAGAGGG - Intergenic
1007726209 6:43917397-43917419 GGGCAGGGGGTGGGGCAGGAGGG - Intergenic
1007762860 6:44143779-44143801 GGGAAGCAGGCAGGGTAAGAGGG + Intronic
1013471736 6:110472360-110472382 GGGCAGCGAGTGGGGCAAGGGGG - Intronic
1014971311 6:127818746-127818768 GGACAACATGTAGGGAAAGATGG + Intronic
1015165110 6:130193902-130193924 GGACAGGAGGGAGGGAAAGAAGG - Intronic
1015278044 6:131404396-131404418 GGACAGGAGGGAGGGAAAGAAGG - Intergenic
1015847345 6:137534722-137534744 GAGCAGCAGGAAGGGAGAGAGGG - Intergenic
1015942933 6:138469970-138469992 GGGAGGCAGGAAGGGGAAGAAGG + Intronic
1016010881 6:139135928-139135950 GGGCAGCAGGCTGGGCCCGAGGG - Intronic
1016396492 6:143628749-143628771 GGGCTGAAGGTGGGGGAAGAGGG + Intronic
1016629510 6:146211990-146212012 GGGCATCAGGAAGGGCAGGCTGG + Intronic
1016918529 6:149267283-149267305 GGACAGCAGGAAGAGGAAGAAGG - Intronic
1017078257 6:150640100-150640122 AGACAGCAGGTAGGGCCAGATGG - Intronic
1017669571 6:156756940-156756962 GGGAAGGAGGGAGGGAAAGAAGG + Intergenic
1017907499 6:158767141-158767163 GGAAAACAGGAAGGGCAAGAGGG + Intronic
1018776623 6:167023167-167023189 GGGTAGCAGAGAGAGCAAGATGG + Intronic
1018864793 6:167737892-167737914 GGGCAGCAGGCAGGGCCGGGAGG - Intergenic
1018926789 6:168212437-168212459 GGGCAGCAGGCAGGGCCGGAAGG + Intergenic
1019001575 6:168757853-168757875 GAGCAGGAGGAAGAGCAAGAAGG - Intergenic
1019609348 7:1929136-1929158 GGGGAGGAGGGAGGGGAAGATGG - Intronic
1019637512 7:2083927-2083949 GGGGAGGAGCTTGGGCAAGAAGG + Intronic
1019643264 7:2115884-2115906 GGGCAGGAGGAAGGGGAAGTGGG - Intronic
1019996015 7:4725008-4725030 GGGCAGCAGGCAGGGTTAGGAGG - Intronic
1020001889 7:4760976-4760998 GGGCAGCAGGTCGGACAAGTGGG - Intronic
1020605101 7:10327230-10327252 GGGGTGAAGGTGGGGCAAGATGG - Intergenic
1020666276 7:11047812-11047834 GGGCAGGAGGGAGGGAAAGAAGG + Intronic
1020789189 7:12604741-12604763 AGGCAGCAGGGTGGGGAAGAAGG + Intronic
1021472739 7:21024333-21024355 GGGCAGGAGGTGGGGAAGGAGGG - Intergenic
1021515215 7:21477078-21477100 GGTCAGCAGCAAGGACAAGATGG + Exonic
1021765281 7:23942842-23942864 GGGCAGCAGGTAGAGCAAGAGGG - Intergenic
1022258946 7:28685590-28685612 GGGAAGCAGGGAGTGAAAGATGG - Intronic
1022815857 7:33913528-33913550 GGGCAGTAGGAATGGAAAGAAGG + Intronic
1022818823 7:33938736-33938758 GGACAGCAGGTTGGGCATGGTGG + Intronic
1022875209 7:34521076-34521098 TGGCAGCAGTCAGGGCAAGGAGG + Intergenic
1023263855 7:38384796-38384818 GGGCAACAAGTACTGCAAGAAGG - Exonic
1023295871 7:38714728-38714750 AGGGAGCAGGCAGGGAAAGAGGG - Intergenic
1023616483 7:42025250-42025272 GGGCAGCAGGTAGGACACCGAGG - Exonic
1024101104 7:46033640-46033662 GGCCAGCAGTTAGGGCAGGTTGG + Intergenic
1024270131 7:47635733-47635755 GGGAAGGAGGGAGGGGAAGAGGG + Intergenic
1024424243 7:49207312-49207334 GGGCAGCAGGAAGAGCATGTAGG + Intergenic
1024506550 7:50167093-50167115 AGGAAGCAGGTAGGGAAGGAGGG + Intergenic
1024531058 7:50393125-50393147 TGGCAGCAGGCATGGAAAGAAGG + Intronic
1025950444 7:66141361-66141383 GGGCAGCAGGGTGGGCGAGGTGG - Intronic
1026002970 7:66577075-66577097 GGGAAGGAGGGAGGGAAAGAGGG + Intergenic
1026365673 7:69645988-69646010 AGGAAGGAGGTAGGGGAAGAAGG - Intronic
1026871569 7:73855924-73855946 GGGCAGCAGGGAGGACCAGGCGG - Intergenic
1028224156 7:88230767-88230789 TGGATGCAAGTAGGGCAAGAGGG - Intergenic
1028477213 7:91265275-91265297 GCCCAGCAGGTTGGGCATGATGG - Exonic
1028642731 7:93061426-93061448 GGGTAGCAGGGAGTGCAACAAGG + Intergenic
1028983979 7:96995889-96995911 GGGGAGCAAGTAGGGGCAGATGG - Intergenic
1029646190 7:101857608-101857630 GTGAAGCAGGAAGGGAAAGACGG + Intronic
1029692376 7:102190869-102190891 GGACAGCAGGAGGGGCAGGAAGG - Intronic
1031214819 7:118877153-118877175 GGGCAGGGGGAAGGGGAAGAAGG + Intergenic
1032463633 7:132129771-132129793 GGGGAGCAGGCAGGGCAGGCAGG + Exonic
1032525778 7:132577378-132577400 GGGAAGCAGGGAGGGCGGGAGGG - Intronic
1032660427 7:133977861-133977883 AGGAAGCAGGGAAGGCAAGATGG + Intronic
1032777897 7:135134088-135134110 GGGAAGCAGGTACTACAAGAGGG + Intronic
1033465444 7:141584986-141585008 TGGTAGCAGGTAGTGCATGATGG + Intronic
1033597292 7:142866849-142866871 GGGCAGAAGCAGGGGCAAGAGGG + Intronic
1034284350 7:149874347-149874369 AGGCAGGAGGTGGGGCGAGAGGG + Intronic
1034594925 7:152180974-152180996 GGGCAGCAGATGGGGAAACACGG + Exonic
1035232861 7:157476801-157476823 GGGCAGAGCGCAGGGCAAGAAGG + Intergenic
1035317520 7:158006092-158006114 GGGCAGCAGGTGCCCCAAGAAGG - Intronic
1035349861 7:158238300-158238322 GGGCAGGAGGGAGGGGAGGACGG - Intronic
1035732003 8:1860113-1860135 GGGCAGCAGGAGGGGCAGGTTGG - Exonic
1036243918 8:7100852-7100874 GGGCAGGAGCCAGGGCCAGAGGG + Intergenic
1037092095 8:14933046-14933068 TGACAGCAGGGAGGGCAGGAGGG + Intronic
1037098026 8:15008729-15008751 GGGGAGGAGGGAGGGGAAGAGGG + Intronic
1038619334 8:29125204-29125226 GGGCAACAGGTAGGGGAAAGAGG + Intronic
1039433778 8:37545766-37545788 AGTCAGCAGGGAGAGCAAGAGGG - Intergenic
1040070288 8:43181667-43181689 GGGTAGCAGATAGGGCAGGGAGG + Intronic
1040542571 8:48373058-48373080 GGGCAGAGGGAAGGGGAAGAGGG + Intergenic
1040716056 8:50253897-50253919 GGGGAGTAGGGAGGGAAAGATGG + Intronic
1041788636 8:61664812-61664834 GGGAAGCAGGAAGGGGAAGGAGG + Intronic
1041815045 8:61961266-61961288 AGTGACCAGGTAGGGCAAGAAGG + Intergenic
1042311011 8:67379477-67379499 GGGCAGCAGTTAAGGCCAGATGG + Intergenic
1042397830 8:68311932-68311954 GGGAAGGAGGAAGGGAAAGAAGG - Intronic
1043041940 8:75274941-75274963 GGGTAGGAGGCAGAGCAAGATGG + Intergenic
1043425657 8:80146049-80146071 GGGCTGTAGGCAGGGCAAGTGGG - Intronic
1043550286 8:81363818-81363840 GGGAAGCAGGCAGGCCAAGTAGG + Intergenic
1044241305 8:89892188-89892210 GGGGAGGAGGCAGAGCAAGATGG + Intergenic
1044552960 8:93532567-93532589 GAACAGCAGGAAGGGCATGAGGG - Intergenic
1044929340 8:97236869-97236891 GGGTAGGAAGTAGGACAAGAAGG - Intergenic
1045290156 8:100826110-100826132 GGGCAGCAGGGATGGGGAGATGG - Intergenic
1046016432 8:108610737-108610759 GGACAGCAGGTAGGGGAGAAAGG + Intronic
1046555421 8:115768201-115768223 GGGAAGAAGGTAAGGGAAGAAGG - Intronic
1046559165 8:115816173-115816195 GGACAGGAGGGAGGGAAAGAAGG - Intergenic
1047876799 8:129147618-129147640 GGGCAGGAGGAAGAGCATGAAGG + Intergenic
1048036862 8:130685270-130685292 GGGCAGAAGGAAGAGGAAGAAGG + Intergenic
1048083538 8:131154006-131154028 AGGCCGCAGGTAGCCCAAGATGG - Intergenic
1048269147 8:133014350-133014372 GGGCTCCAGGCAAGGCAAGAGGG + Intronic
1048791731 8:138110472-138110494 GGGCAGAAGTGAGGGCAAGGTGG + Intergenic
1049403657 8:142442208-142442230 GGGCAGCTGCTAGGGCTACAGGG - Intergenic
1049599822 8:143502277-143502299 GGGCAGGAGGTGGGGCAGGGTGG + Intronic
1049709811 8:144058413-144058435 GGGCAGCAGGCGGGCCATGAGGG + Intronic
1049714792 8:144084778-144084800 GGGGAGCAAGTAGAGGAAGAAGG - Exonic
1049731407 8:144180452-144180474 GGGCAGCAGGGAGCTCAGGACGG - Exonic
1049769825 8:144374654-144374676 GGGCAGCAGGCTGGGCAGGGAGG - Intronic
1050661824 9:7891307-7891329 AGGCAGAAAGTAGGGCTAGAAGG - Intergenic
1052069133 9:24059737-24059759 GGGGAGAAAGTTGGGCAAGAAGG - Intergenic
1052097632 9:24403357-24403379 GGGCAGAAGGTAGGGGAGCAGGG + Intergenic
1053454671 9:38225029-38225051 GGGAAGCAGGTAGAGAAAAAGGG - Intergenic
1054858356 9:69925005-69925027 GGGCCTCAGGAAGGGGAAGAAGG - Intergenic
1054947822 9:70814851-70814873 GGGAAGCAGGAAGGGAGAGAGGG - Intronic
1055203403 9:73695832-73695854 GAGCAGCAGCAAGAGCAAGAGGG - Intergenic
1056098498 9:83278258-83278280 GGGCAGGAGGCAAAGCAAGAAGG + Intronic
1056099901 9:83291380-83291402 CTGCAGCAGGTAGGGCAAGCGGG - Intronic
1056795897 9:89658701-89658723 GTGCAGCAGGCATGGCATGAGGG - Intergenic
1057266352 9:93620354-93620376 GGGCAGCAGGTGAGGCACGAGGG + Intronic
1057461730 9:95269215-95269237 GGAAAACAGGTAGGGGAAGAGGG - Intronic
1057722674 9:97545567-97545589 AGGCAGCGGGTAGGGCCAGCAGG + Intronic
1059457754 9:114410512-114410534 AGGCAGCAGGTGGGGACAGAAGG + Intronic
1059812135 9:117867199-117867221 GGGCAGCAGGTGGTAGAAGATGG + Intergenic
1060135418 9:121148759-121148781 GGGCAGCAGGATGGGAAGGAAGG + Exonic
1060155441 9:121316997-121317019 GGACAGGGGGTGGGGCAAGATGG + Intronic
1060518933 9:124282974-124282996 GGGCAGCCTGTGGGGCAGGAAGG + Intronic
1060547004 9:124467800-124467822 GGCCACCAGGAAGAGCAAGAAGG - Exonic
1061010344 9:127950892-127950914 GGTCAGCAGGCAGGGGAGGAGGG + Intronic
1061498276 9:130988013-130988035 GAGCAGAAGGGAGGGCAAGAGGG + Intergenic
1061776898 9:132971604-132971626 GGGAAGCAGGGAGGAAAAGAGGG + Intronic
1061976455 9:134070319-134070341 GAGCAGCGGGAAGGGAAAGAAGG - Intergenic
1062025616 9:134338886-134338908 GGTCAGCAGGGAGGGCAGAACGG - Intronic
1062110309 9:134778650-134778672 AGGCAGCCGGGAGGGCAAGGTGG - Intronic
1185834078 X:3329000-3329022 GGGAAGCAGGGAGGGAAGGAGGG + Intronic
1186489390 X:9959673-9959695 GGGAAGGAGGGAGGGCAGGAAGG - Intergenic
1188277288 X:28216005-28216027 GGGAAGGAGGGAGGGAAAGAGGG - Intergenic
1189196703 X:39159625-39159647 GGCAAGCAGATAGGGCAGGATGG + Intergenic
1189670473 X:43402996-43403018 GGGCAGAAGGTAGGGGAAGATGG + Intergenic
1190368392 X:49718936-49718958 GGAGGGGAGGTAGGGCAAGATGG - Intergenic
1190530236 X:51367785-51367807 GGGGAGAAGGTGGAGCAAGATGG + Intergenic
1190614436 X:52216376-52216398 GTGGAGGAGGTAGAGCAAGATGG + Intergenic
1190746547 X:53326564-53326586 AGGCAGCAGGTGGGTAAAGAAGG - Intergenic
1193692691 X:84667190-84667212 GGGCTGGAGGTAGAGCAAGATGG + Intergenic
1195263619 X:103158927-103158949 GGGCAGAAGGTGGGGCAGAAGGG - Intergenic
1195547379 X:106127496-106127518 GGGCAGGGGGTAGGGAAAAACGG - Intergenic
1195585836 X:106564708-106564730 TGGCAGCAGGGATGGAAAGAAGG - Intergenic
1196368702 X:114951710-114951732 GGGAGGCAGGCAGAGCAAGATGG + Intergenic
1197720911 X:129744090-129744112 GGGTAGCAGAGAGGGCAAGGGGG - Intronic
1198278238 X:135117654-135117676 GGGCAGCAGGTAGGGCAAGAAGG - Intergenic
1198292724 X:135254862-135254884 GGGCAGCAGGTAGGGCAAGAAGG + Intronic
1198300743 X:135332117-135332139 GAGCAGCAGGTAGGCCAAGAAGG + Intronic
1198307896 X:135400622-135400644 AAGCAGCAGGTAGGGCAAGAAGG + Intergenic
1198963849 X:142207729-142207751 GGTAAGCAGGAAGGGCTAGAAGG - Intergenic
1198995374 X:142567809-142567831 GGGTAGTAGGTAGAGCAAGATGG - Intergenic
1199692627 X:150320299-150320321 GGGCACCAGGTAGGGCAGGAAGG + Intergenic
1199846442 X:151695375-151695397 GGGCAGCGGGGAGGGGAGGAAGG + Intronic
1199992065 X:152993011-152993033 GGGCTGCTGGTAGGGCAGAAGGG + Intronic
1200244828 X:154517351-154517373 GGGCAGCCGGCAGGGCAGAAGGG - Intergenic
1201414265 Y:13731955-13731977 GGGCAGATGGTAGGGAGAGATGG - Intergenic