ID: 1198293009

View in Genome Browser
Species Human (GRCh38)
Location X:135257046-135257068
Sequence GCCATGGGCCTTGGGCTCTG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 377
Summary {0: 1, 1: 0, 2: 6, 3: 36, 4: 334}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1198293003_1198293009 -1 Left 1198293003 X:135257024-135257046 CCCAGCGAGATGCAGGGAGTAAG 0: 1
1: 0
2: 1
3: 13
4: 154
Right 1198293009 X:135257046-135257068 GCCATGGGCCTTGGGCTCTGAGG 0: 1
1: 0
2: 6
3: 36
4: 334
1198292999_1198293009 19 Left 1198292999 X:135257004-135257026 CCCTTGGGCACTGAATAACACCC 0: 1
1: 0
2: 4
3: 34
4: 289
Right 1198293009 X:135257046-135257068 GCCATGGGCCTTGGGCTCTGAGG 0: 1
1: 0
2: 6
3: 36
4: 334
1198293000_1198293009 18 Left 1198293000 X:135257005-135257027 CCTTGGGCACTGAATAACACCCA 0: 1
1: 0
2: 4
3: 40
4: 371
Right 1198293009 X:135257046-135257068 GCCATGGGCCTTGGGCTCTGAGG 0: 1
1: 0
2: 6
3: 36
4: 334
1198293004_1198293009 -2 Left 1198293004 X:135257025-135257047 CCAGCGAGATGCAGGGAGTAAGC 0: 1
1: 0
2: 1
3: 9
4: 104
Right 1198293009 X:135257046-135257068 GCCATGGGCCTTGGGCTCTGAGG 0: 1
1: 0
2: 6
3: 36
4: 334

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1198293009 Original CRISPR GCCATGGGCCTTGGGCTCTG AGG Intronic
900095164 1:937259-937281 TCCCTGGGCCCTGGGCTGTGAGG + Intronic
900353426 1:2248132-2248154 GCCAGGCCCCTAGGGCTCTGGGG - Intronic
900410068 1:2508385-2508407 GCCCGGGGCCATGGGGTCTGCGG + Intergenic
900699045 1:4032659-4032681 GCCAGGGGCCATGGGCTGGGTGG + Intergenic
900883281 1:5397657-5397679 CCCAGGGGCCTTCGGCTCTGGGG - Intergenic
900935766 1:5765538-5765560 GTCAGGGGTCTTGGGCTCTCAGG - Intergenic
900960371 1:5915211-5915233 GCCTTGGGCCTTGGGCCTTGGGG + Intronic
901038334 1:6349621-6349643 GCACTGGGCCTTGGGAACTGTGG - Intronic
901153546 1:7120692-7120714 AGCATGGGCTTTGGGATCTGTGG - Intronic
901380699 1:8871863-8871885 GCCATGGGCTGTGGGTTCTAAGG + Intronic
901500819 1:9651852-9651874 GCCAGGGGCTTTGGGAGCTGCGG + Intronic
901635942 1:10670150-10670172 GCCCTGGGCCATGGTGTCTGGGG + Intronic
902232228 1:15035424-15035446 GACATATGCATTGGGCTCTGTGG + Intronic
902330879 1:15730744-15730766 GGCCTGGGGCTTGGGCCCTGGGG + Intronic
902601969 1:17546112-17546134 GTCAGGGGCCTTGTGCTGTGTGG + Intronic
902670052 1:17966908-17966930 GCCATGGCCCTGGGTCTGTGAGG - Intergenic
902937825 1:19777242-19777264 GCCTTGGGCCTTGTCCTGTGAGG + Intronic
903141585 1:21342419-21342441 GCCGTGGGCCGAGGGTTCTGAGG - Intronic
903272101 1:22196059-22196081 GCCAAGGGACTTGGCCTTTGAGG - Intergenic
903378237 1:22879820-22879842 GCCAGGGGCATTGGCCTCTTGGG - Intronic
903424576 1:23244405-23244427 GCCACTGGCCTTAGGCTCAGTGG + Intergenic
904264950 1:29312863-29312885 CCCTTTGGCCTTTGGCTCTGAGG + Intronic
905369396 1:37474996-37475018 GCCATGGGCCTTGCGCTGCCTGG + Intronic
905572618 1:39017727-39017749 TCCATGGCCCTTGGGTTCTTGGG - Intergenic
906144506 1:43551902-43551924 TCCAGGGGCCAGGGGCTCTGGGG - Intronic
906203904 1:43976783-43976805 GCCGATGGCCTTGGGGTCTGTGG - Exonic
907414843 1:54307148-54307170 GCCCTGGGCCCTGGGCTCTAGGG - Intronic
908510235 1:64845381-64845403 TCCATGGGGCCAGGGCTCTGTGG - Intronic
909271353 1:73627366-73627388 GCCATGAGCCTGGGGCAGTGAGG + Intergenic
914558478 1:148792531-148792553 GCCTTGGGGCTTGGGATGTGTGG + Intergenic
914614357 1:149337699-149337721 GCCTTGGGGCTTGGGATGTGTGG - Intergenic
919848247 1:201655255-201655277 GCTTTGGGCTTTGGGCTTTGGGG - Intronic
919879668 1:201893363-201893385 GTCATGGTCCTTGTGCTCTCAGG + Intergenic
920102441 1:203525773-203525795 GCCCTGGGCCTGGTGGTCTGTGG - Intergenic
920436999 1:205953499-205953521 GGCCTGGGGCTTGGGGTCTGTGG - Intergenic
920577459 1:207072058-207072080 GCCATGGGCCATGCCCTGTGAGG + Intronic
921927798 1:220726936-220726958 GCGTTGGTCCTTGGGCTCTGGGG - Intergenic
922475466 1:225904442-225904464 GGCATGGGCCTGGGGCTCAGAGG - Intronic
922699236 1:227748714-227748736 GGGATGGGCCCTGGCCTCTGAGG + Intronic
923835840 1:237609766-237609788 GTCATGGGCCTGGGGGTTTGGGG - Intronic
1064138478 10:12770724-12770746 GACTTGGGCCTTGGTCTCAGTGG + Intronic
1064455208 10:15481164-15481186 GACATGGTCCCTGGGTTCTGGGG - Intergenic
1065115686 10:22480457-22480479 CACATGGGCCTTTGGTTCTGTGG - Intergenic
1066654677 10:37686898-37686920 GCCATGTGTCTTGCCCTCTGTGG - Intergenic
1067053836 10:43040156-43040178 CCCATGGGCCATGGGCTCACTGG - Intergenic
1067523773 10:47026569-47026591 CCCTGGGCCCTTGGGCTCTGGGG + Intergenic
1068083336 10:52346739-52346761 CCCCAGGGCCCTGGGCTCTGGGG - Intergenic
1069382273 10:67853108-67853130 GCCCTAGGCCTTGTCCTCTGTGG - Intergenic
1069713548 10:70506418-70506440 GCGCTGGGCCCTGGGGTCTGTGG + Intronic
1069965171 10:72109348-72109370 GAGAGGGGACTTGGGCTCTGGGG - Intronic
1072656283 10:97332808-97332830 GTCATGGGCCTCGGCCTCGGCGG - Exonic
1073141191 10:101249149-101249171 GCTATGGCCCCTGGGCTCTGGGG + Intergenic
1077085576 11:748220-748242 GCCATCGCCCTTGAGCCCTGCGG + Intronic
1077372794 11:2191330-2191352 GCCTGGGGCCTAGGACTCTGAGG + Intergenic
1077374161 11:2197774-2197796 GCCATGGGGCTTGGGCTTAACGG + Intergenic
1078621729 11:12914738-12914760 GCACTGGGCCTGGGGCTGTGGGG - Intronic
1079079237 11:17402515-17402537 CCCTTGGGCCTTGGGACCTGAGG + Intronic
1081618991 11:44607774-44607796 GGCATGGGCCTTGGACTCCAAGG - Intronic
1081745189 11:45468011-45468033 TGCATGGGCCATGGGTTCTGTGG - Intergenic
1081854609 11:46295665-46295687 GCCATTGGCCAGGAGCTCTGCGG + Intronic
1082762945 11:57144576-57144598 GCCATGGGCCATGGGGAATGGGG - Intergenic
1082926313 11:58551095-58551117 ACAATGGCCCTTGGGCACTGTGG + Exonic
1083183519 11:61004043-61004065 GCCATGGGCCCTGCCCTCTAGGG + Intronic
1083319563 11:61837585-61837607 GCCATTGGCGTTGGGCACTGAGG + Intronic
1083745839 11:64736026-64736048 ACCTTTGGCCCTGGGCTCTGTGG - Intronic
1083746816 11:64741599-64741621 GGGATGGGGCTTGCGCTCTGCGG + Intronic
1084209799 11:67615656-67615678 GCCATTGGCCTCAGGCTCCGCGG - Intergenic
1084321083 11:68373671-68373693 GCCTTGGTCCTGGGGCTGTGTGG - Intronic
1085176580 11:74493466-74493488 GCTACGGGCCTTGGGCGCCGAGG - Exonic
1085391394 11:76184154-76184176 CCAATGGGCCCTGGGATCTGGGG - Intergenic
1085982810 11:81744780-81744802 GCCACTGGCCCTGGGCACTGAGG - Intergenic
1088448315 11:109955399-109955421 GCCATGGGGCCTGGGCCCAGGGG + Intergenic
1088788063 11:113200547-113200569 GCCAGGAGGCCTGGGCTCTGGGG + Intronic
1089321118 11:117627376-117627398 CCCATGGGTCTTGGGCACAGGGG + Intronic
1089397088 11:118143283-118143305 GACATGGCCCTTGTCCTCTGGGG - Intronic
1089697719 11:120226149-120226171 GGCTAGGGGCTTGGGCTCTGAGG + Intronic
1089992226 11:122872243-122872265 GCCTTGGGGCATGGGTTCTGGGG - Exonic
1091350227 11:134888057-134888079 GCCCTGGGCCCTGAGTTCTGGGG - Intergenic
1092897669 12:13028992-13029014 GCCACGTGCCCTGAGCTCTGGGG + Intergenic
1094763442 12:33561894-33561916 GGGATGGTCCTTGGGCCCTGGGG - Intergenic
1095282629 12:40373801-40373823 GACATGGGCCCTGGGCTGTTGGG + Intergenic
1096112552 12:49038064-49038086 GCCAGGACCCTTGGGCCCTGAGG - Exonic
1097022044 12:56027470-56027492 TCCTTGGGCCTTGGGCTCCTAGG + Intronic
1097197137 12:57249225-57249247 CCCATTGGCCTGGGGCTCTGGGG + Exonic
1099934676 12:89110796-89110818 GGCATGCGCCTGGGGGTCTGAGG + Intergenic
1101656852 12:106730041-106730063 GACCTTGGCCTTGAGCTCTGTGG + Intronic
1101955006 12:109205378-109205400 GCCCTTGGCCCTGGGCTGTGGGG + Intronic
1102031623 12:109743243-109743265 GTCAGGGGCTTTGGGCTCTCAGG + Intronic
1102222110 12:111201595-111201617 TCCGAGAGCCTTGGGCTCTGGGG - Intronic
1102617562 12:114167915-114167937 GCCTTAGGCGTTGGCCTCTGGGG - Intergenic
1102956556 12:117062864-117062886 GCCGTCAGCCCTGGGCTCTGAGG - Intronic
1103237951 12:119389698-119389720 GCCTTGGGTCTGGGGCTCAGGGG - Intronic
1103521850 12:121541310-121541332 GCCTTGGGCCCAGGACTCTGAGG + Intronic
1105280326 13:18959408-18959430 GCCCTGGGCCTTGAGGCCTGAGG + Intergenic
1106023503 13:25936351-25936373 GCCATGGGCCTGAGTGTCTGCGG + Intronic
1106593196 13:31115424-31115446 GCAATTGGCCTTGGACACTGAGG - Intergenic
1106787886 13:33125172-33125194 ACCCTGGTCCTTGGGCTCAGTGG - Intronic
1108438113 13:50421264-50421286 CCCAGAGGCCTTGGGCTTTGAGG + Intronic
1113037702 13:106069635-106069657 TTCATTGGCCTTGGGCTTTGTGG - Intergenic
1114852277 14:26395349-26395371 GCCATAGTCCTTGAGCTATGAGG + Intergenic
1115199751 14:30840380-30840402 GACATGGTTCTTGGGCTCTTGGG + Intergenic
1115733286 14:36295734-36295756 GCCCAGGGCTTTGGGCTCCGTGG - Intergenic
1116341628 14:43730251-43730273 GCCTTGTGCCTTGAGCTCTGGGG + Intergenic
1117293843 14:54360927-54360949 GCCTGAAGCCTTGGGCTCTGTGG + Intergenic
1117412785 14:55465986-55466008 GCCATGGGGCTTGGGGTGGGAGG - Intergenic
1117658147 14:57977649-57977671 GCCATGAGACTTGGGATCAGTGG - Intronic
1118320269 14:64748734-64748756 GCTCTGGGCCAGGGGCTCTGGGG - Exonic
1119029847 14:71183406-71183428 AACATGGGCCTTGCCCTCTGAGG + Intergenic
1119433927 14:74585818-74585840 TCCATGGGGCTTGGGGTCTGGGG - Intronic
1119595172 14:75926066-75926088 GCCGTGGGCCGTGGGCCGTGGGG + Intronic
1119831626 14:77707971-77707993 GGCAGCGGCCGTGGGCTCTGTGG - Exonic
1122305429 14:100763108-100763130 GCCAGGGGCCTTGGGTACAGCGG + Intergenic
1122626867 14:103089417-103089439 CCCCTGGGACTTGGGCTCTGGGG + Intergenic
1123018178 14:105385352-105385374 TCCCTGGGCCTCGGGCCCTGTGG + Intronic
1123026295 14:105425853-105425875 GCCTTGGGGCCTGGGCTCGGGGG - Intronic
1123940129 15:25212725-25212747 CCCATGGGCTTTGGGCTAAGGGG + Intergenic
1124432257 15:29617820-29617842 GCCCTGGGCCTCAGGCTCAGCGG - Intergenic
1127971482 15:63965728-63965750 GCCATAGGCCTGGGGCAGTGGGG - Intronic
1128113164 15:65089042-65089064 GACCTGGCCCTTGGGATCTGAGG + Intergenic
1128945005 15:71813900-71813922 GACATGGACCTGGGGCCCTGTGG - Intronic
1129451089 15:75651763-75651785 TCCCTGGCCCTTGGGCCCTGAGG + Intronic
1129452374 15:75658260-75658282 CTCAGGGTCCTTGGGCTCTGTGG + Exonic
1129607452 15:77031758-77031780 GCCAGGGTCCCTGAGCTCTGTGG + Intronic
1131028852 15:89169207-89169229 GGCAAGGGGCTTGGGCTTTGGGG + Intronic
1132025330 15:98400140-98400162 CCCATGGTGCCTGGGCTCTGTGG - Intergenic
1132701811 16:1225233-1225255 ACCATGGCCCTTGGGGCCTGTGG - Exonic
1133052902 16:3128142-3128164 ACCATTGGCCTTTGGCTCTCAGG + Intergenic
1133170923 16:3982141-3982163 GCCATGGGCCATGCTGTCTGTGG - Intronic
1133221694 16:4321667-4321689 GCCAGGGGCCGTGGGAACTGGGG + Intronic
1134025125 16:10947413-10947435 GCCATGGACCCAGGGTTCTGTGG + Intronic
1135047463 16:19167632-19167654 GCCAGAGGCCTTGGGCTGGGAGG + Intronic
1135227525 16:20674661-20674683 CCCATGGGACTAGGGCCCTGGGG + Intronic
1135732466 16:24906595-24906617 TGCCTGGGCCTGGGGCTCTGGGG + Intronic
1135976223 16:27110327-27110349 GCCCTGGCCCTTGGGATCTCTGG + Intergenic
1139213394 16:65103071-65103093 GCCATGGTGCTTGGGCCATGTGG - Intronic
1140890364 16:79279650-79279672 GCCACGGTCCTTGCCCTCTGGGG - Intergenic
1141698592 16:85632245-85632267 GCCATGGGCATGGGGCTCTCAGG + Intronic
1142140011 16:88468687-88468709 GCCATGGGGGTGGGGCTCTGGGG - Intronic
1142223533 16:88866520-88866542 GCCCTGGGCCTCAGGGTCTGAGG + Exonic
1142315450 16:89341860-89341882 GCCGTGGGCCGTGGCCGCTGTGG - Intronic
1142315461 16:89341902-89341924 GCCGTGGGCCGTGGCCGCTGTGG - Intronic
1142315493 16:89342034-89342056 GCCGTGGGCCGTGGCCGCTGTGG - Intronic
1143384208 17:6517425-6517447 GCCAGGGGCCATGGGAGCTGGGG + Intronic
1144586240 17:16489671-16489693 GTCATGGGCCTTGAGCAGTGTGG - Intronic
1144787156 17:17838246-17838268 CCCCAGGGACTTGGGCTCTGTGG - Intergenic
1144819919 17:18065387-18065409 GCCATGCTCCTTGGATTCTGTGG - Exonic
1146013218 17:29212247-29212269 ACCAAGGGCCTAGGGCTCTATGG + Intergenic
1147166500 17:38596255-38596277 GCCATGGGCCATGGGGTTGGGGG + Intronic
1147985909 17:44307945-44307967 ACGAAGGGCCTTGGGCTCTGCGG - Intergenic
1148027983 17:44601507-44601529 GGCAGGGGCCGTGGGCCCTGTGG + Intergenic
1148820329 17:50356269-50356291 GCCAGGGGCCTTGGGGCCTCGGG - Intronic
1149661864 17:58338287-58338309 GTCATGGGGCTGCGGCTCTGGGG + Intergenic
1150135456 17:62692760-62692782 GGCCTGGGCCGGGGGCTCTGGGG - Exonic
1150288865 17:63970267-63970289 ACCATGGGCCAGGGGCTGTGAGG + Intronic
1151343065 17:73484289-73484311 ACCAAGGGGCTGGGGCTCTGTGG + Intronic
1151438157 17:74111088-74111110 GCCATGGGGCTTGGACACTGTGG + Intergenic
1151698263 17:75729197-75729219 GCCAGGGGCACTGGGGTCTGCGG + Intronic
1152027697 17:77822460-77822482 CGCATGGGCCTTGGGGTCTCTGG - Intergenic
1152636368 17:81432178-81432200 GCCAGTGGCCTTGGTCACTGGGG + Intronic
1152676754 17:81645235-81645257 GCCCTGGCCATCGGGCTCTGGGG + Exonic
1156541778 18:37919156-37919178 GCCCTGGGCCTAAAGCTCTGGGG - Intergenic
1161135536 19:2617380-2617402 GCCTTGGGCTGTGAGCTCTGAGG + Intronic
1161173063 19:2822972-2822994 GCCAAGGGCTCTGGGATCTGGGG + Intronic
1161297320 19:3526538-3526560 GTCAGGGGCCCTGGGATCTGAGG + Intronic
1161537727 19:4830710-4830732 GCCATGAGCCGGGGGCTGTGTGG + Intronic
1161681016 19:5679814-5679836 CCCGTGGGCCTTGGCCCCTGAGG - Intronic
1162114684 19:8421798-8421820 ACCATGGGCCTCAGGCCCTGAGG + Exonic
1162372997 19:10290095-10290117 GCTCTGGGCCTGGGGCTCTTCGG + Exonic
1162796754 19:13091076-13091098 CCCAAGGGCACTGGGCTCTGTGG - Intronic
1163628037 19:18402120-18402142 GCCGGGGGCCTTGGAGTCTGAGG + Intergenic
1163796575 19:19341469-19341491 CCAATGGGTCTTGGGCTGTGAGG + Intronic
1163837118 19:19581782-19581804 GCCATTGGCTTTGGGAGCTGAGG + Intronic
1164593535 19:29519282-29519304 GCCCTGGGACTTGGGCACAGGGG + Intergenic
1164809661 19:31146318-31146340 GCAAGGGGACCTGGGCTCTGTGG + Intergenic
1164907434 19:31978676-31978698 ACCGTGTGCCTTGGGCCCTGTGG - Intergenic
1165463385 19:35958076-35958098 CCCCCGGGCCCTGGGCTCTGAGG + Intergenic
1166871330 19:45872775-45872797 GCCCTGGGCCTCAGGCTCAGGGG - Exonic
1167096079 19:47375715-47375737 GCCATGGGCTGTGGGGTGTGGGG + Intronic
1167359002 19:49019987-49020009 GCCATGGGTCTTGGGCACGTAGG + Intergenic
1167366686 19:49058224-49058246 GCCATGGGTCTTGGGCACGTAGG + Exonic
1167698091 19:51026540-51026562 GCTCTGGGGCTGGGGCTCTGGGG + Intronic
1167762324 19:51457537-51457559 GCCGTGGTCCTGGGGCTTTGGGG + Exonic
1168136414 19:54355305-54355327 GCCATGGGCTTTGTGGACTGTGG + Exonic
925267620 2:2577554-2577576 GGCCTGGGCCTTGGTCTCTGTGG + Intergenic
925426681 2:3754451-3754473 GCCATGAGCCGTGTCCTCTGTGG + Intronic
926206320 2:10836331-10836353 GTCTGGGGCTTTGGGCTCTGTGG + Intronic
927680770 2:25137523-25137545 GGCATGGGGCTTGGGATCAGGGG + Intronic
927937045 2:27082023-27082045 AGCAGGGGCCTTGAGCTCTGGGG + Intronic
928203644 2:29268501-29268523 TGCAGGGGCCTGGGGCTCTGAGG - Intronic
928204661 2:29275349-29275371 GCCATGGGCCATGGGGGTTGGGG + Intronic
929231472 2:39564878-39564900 TCCAGGGGCCTAGGGATCTGGGG - Intergenic
929922862 2:46184979-46185001 GACATGGGACTGGGGCTCCGAGG - Exonic
932819540 2:74887676-74887698 CCCACGGGCCTCGGGCACTGTGG + Intronic
933634655 2:84694161-84694183 GCCACCAGCCTTTGGCTCTGGGG + Intronic
935876201 2:107510914-107510936 CCCATGGGCTTGGGGCTCTGTGG + Intergenic
936058669 2:109280342-109280364 GCCAGTGGCAGTGGGCTCTGAGG + Intronic
936247835 2:110843964-110843986 ACCATCGACCTTGGGATCTGGGG + Intronic
936462120 2:112721754-112721776 TCCTTGGGCCTTGGATTCTGGGG + Intronic
937228096 2:120381370-120381392 GCTATAGGCTGTGGGCTCTGGGG + Intergenic
937349212 2:121149864-121149886 TGCATGGCCCTTGGCCTCTGTGG - Intergenic
938048027 2:128140580-128140602 TCCATGTCTCTTGGGCTCTGCGG + Intronic
938238197 2:129723223-129723245 TCCATGGGTCTTGGCCTCTGGGG + Intergenic
938289457 2:130141737-130141759 GCCATGAGCCCAGGGCTCCGTGG + Intronic
938337676 2:130513690-130513712 GCCTTGGGGCTTGTGCCCTGTGG - Intergenic
938352163 2:130607045-130607067 GCCTTGGGGCTTGTGCCCTGTGG + Intergenic
938370312 2:130764170-130764192 GACATGGGCAGTGGGCTCTTTGG + Exonic
938422294 2:131154992-131155014 GCTATGGGCCGTGGGCTGCGAGG + Intronic
938467071 2:131531201-131531223 GCCATGAGCCCAGGGCTCCGTGG - Intronic
941756453 2:169191726-169191748 ATCATGGGCCCTGGGCACTGTGG + Intronic
945957333 2:216098610-216098632 GGCATGGACCTTGGGCCCTGTGG - Intronic
946411996 2:219520095-219520117 GCCAGGAGCCTGGGGCCCTGTGG + Intronic
948719797 2:239892294-239892316 GCCATGCACCCTGGGCACTGGGG - Intergenic
949027690 2:241774127-241774149 TCCATGGCCCTGGGGCCCTGGGG + Intergenic
1168740826 20:189938-189960 GTCGTGGGCCTTGGGTTGTGTGG + Intergenic
1169235435 20:3926363-3926385 GCCAGGGGCCTGTGGCTCAGGGG + Intronic
1170889904 20:20368183-20368205 GCAATGGGCCGGGGGCACTGAGG + Exonic
1171475834 20:25407930-25407952 GCGTTGGGCCCTGGGCTCTGGGG + Intronic
1172213132 20:33214850-33214872 GTCAGGAGCCGTGGGCTCTGGGG - Intergenic
1172272058 20:33660264-33660286 GCCATGGGCCTGGGCCTCCAGGG + Exonic
1172410208 20:34715873-34715895 ACCATGGGCCTTGGTCAGTGAGG + Intronic
1173341330 20:42155319-42155341 GCCAAGGGCCTTGGGCTCCTAGG - Intronic
1174422020 20:50405470-50405492 CCCATGGACCTTGGTCACTGTGG + Intergenic
1175391128 20:58628084-58628106 GCAAAGGGCCTTGGGGGCTGTGG + Intergenic
1175508554 20:59505186-59505208 GCCATGAGCCTAGGACTGTGAGG - Intergenic
1175576964 20:60067424-60067446 GCCACGGACCTCGGGCTGTGTGG - Intronic
1176102772 20:63372172-63372194 GACAGTGGCCCTGGGCTCTGAGG - Intronic
1176151905 20:63595803-63595825 GCCAGGTGCCTTCGGCTCTGGGG - Intronic
1176216622 20:63951150-63951172 GCCTGTGGCCTTGGCCTCTGAGG - Intronic
1176738041 21:10570954-10570976 GGGATGGGCCTTGGGCCTTGGGG - Intronic
1178398220 21:32261141-32261163 GCCATGGGGCCTGGGGTTTGTGG - Intergenic
1178518394 21:33267053-33267075 GCCATGGAGCTGGGGCGCTGGGG - Intronic
1179011251 21:37557872-37557894 GCCCTGGACCTTGGACTCTGGGG - Intergenic
1179308501 21:40176269-40176291 GTGCTGGGCATTGGGCTCTGGGG + Intronic
1179713154 21:43274527-43274549 ACCACGGCCCTTGGGGTCTGTGG - Intergenic
1180137688 21:45871783-45871805 TCCATGGAACTGGGGCTCTGAGG - Intronic
1180182892 21:46125736-46125758 GCCAGAGGCCTCGGGGTCTGGGG - Intronic
1181108700 22:20589372-20589394 GCCATGAGCCCAGGGCTCCGTGG + Intergenic
1181475014 22:23162659-23162681 GACAGGGGCCTGGGGCTGTGGGG - Exonic
1181590774 22:23883715-23883737 GCCATGGTCCCTGAGGTCTGGGG - Intronic
1181736647 22:24886740-24886762 GCCATGGGCACTGGGATCTTTGG + Intronic
1182112071 22:27731046-27731068 GACAAGGGCCTGGGCCTCTGGGG + Intergenic
1183115110 22:35685845-35685867 GGCCTGGGTCTGGGGCTCTGTGG + Intergenic
1183315742 22:37136020-37136042 GCCATGGGCCTTGTGAGTTGGGG - Intronic
1183332956 22:37231209-37231231 GGTATGGGCCTCGGGCTCAGAGG - Exonic
1183597920 22:38823298-38823320 GCCATGGGCCTTGGGCCTTGGGG - Intronic
1184662030 22:45969861-45969883 GGCATTGGCCTTTGGATCTGAGG - Intronic
1184953314 22:47861745-47861767 GCCATGGGCCTTCGCTTATGAGG + Intergenic
952819462 3:37473429-37473451 GCCATCAGCCTTGGGCTGTCGGG - Exonic
953396150 3:42572079-42572101 GCTAGGGACCTTGGGGTCTGAGG + Intronic
953760406 3:45682462-45682484 GCCTTGGGCATTGGGCCATGTGG + Exonic
954224989 3:49175612-49175634 GCCATGTCCTTTGGGCTCTGTGG + Exonic
954425822 3:50442641-50442663 CCCATGGGCCCTGGGATATGTGG - Intronic
954540556 3:51390892-51390914 TCCATGGCCGTTGGGATCTGGGG - Intergenic
956900475 3:73710501-73710523 GTCATGGGCTTTGTGTTCTGTGG + Intergenic
957292191 3:78292304-78292326 GCCTTGCTCCTTGGGCTGTGGGG - Intergenic
957723173 3:84031331-84031353 GCCATGGGCCTTTGGATCCCTGG + Intergenic
960639657 3:119813396-119813418 GACCTGACCCTTGGGCTCTGAGG - Intronic
961456566 3:127027504-127027526 GCCATGGGCGGTGGGCCATGGGG + Intronic
961459154 3:127039325-127039347 GCCACGGGCCACGGGCCCTGGGG - Intergenic
961530875 3:127539663-127539685 GCCCTGGGACATGGGCTCCGTGG - Intergenic
961552647 3:127677907-127677929 GCCAGGGCCCTGGGGGTCTGTGG + Intronic
961642216 3:128371772-128371794 ACCATGGGGCTGGGACTCTGGGG - Intronic
961885565 3:130094333-130094355 GTCTTGGGCCTGGGGCTATGTGG + Intronic
962072036 3:132043786-132043808 GCAATGGGCCTTGGCTCCTGTGG + Intronic
962089418 3:132227569-132227591 GCAATGGGCCTTGTTCTGTGTGG + Intronic
962199334 3:133388778-133388800 GCCCTGGGCTCTGGGCTGTGAGG + Intronic
965956504 3:174377241-174377263 GCCATGGGCCTCATGGTCTGTGG + Intergenic
968299061 3:197599488-197599510 GCCAAGTGCCTTGGGATCTGAGG + Intergenic
968618506 4:1593026-1593048 GCCCTCGGCCCTGGGCACTGGGG - Intergenic
968944144 4:3654799-3654821 GCCCTGGGTCTTGAGGTCTGTGG + Intergenic
969292767 4:6251466-6251488 GCCATGGGCCTCCAGATCTGAGG + Intergenic
969304453 4:6317818-6317840 GCCAGGGGGCCTGGGCTGTGGGG + Intergenic
969613352 4:8238837-8238859 GCCATGGACTTTGGCCTCTCAGG - Intronic
971151057 4:24031948-24031970 ACCATGGGCATTGTGGTCTGAGG - Intergenic
972928429 4:44040725-44040747 GCTATGGGCCTTCGGCTCTGAGG + Intergenic
974356124 4:60814786-60814808 ACCATGGGCCGTTTGCTCTGTGG + Intergenic
976103641 4:81593120-81593142 GCAATGGGCAGTGGGCACTGAGG + Intronic
976403549 4:84636041-84636063 GCCACCGCCCCTGGGCTCTGTGG + Intronic
983696340 4:170537104-170537126 GACTTGGGCCATGGGCTCTGAGG - Intergenic
984514783 4:180724611-180724633 GCCAAGGGCTTTGGGCTCTGGGG + Intergenic
984529777 4:180902079-180902101 GCTGTGGTCCTTGGGATCTGAGG - Intergenic
985064004 4:186104562-186104584 GCCCTGGGCCCTGAGCTCGGCGG + Intronic
986335687 5:6753657-6753679 GTGATGTTCCTTGGGCTCTGCGG + Intronic
986419523 5:7564706-7564728 GCTAAGGGCCTTGGGCTTTGAGG + Intronic
988035587 5:25823571-25823593 ACCATGGGCCTTGGGCAGTGAGG - Intergenic
989606927 5:43253401-43253423 GCAATGGGTCTTGAGGTCTGAGG + Intronic
991661358 5:68954036-68954058 GTCATGGACCCTGAGCTCTGGGG - Intergenic
994040214 5:95250299-95250321 CCCATGGGACTTGGGGGCTGAGG + Intronic
995265344 5:110152822-110152844 ATCATGGATCTTGGGCTCTGAGG + Intergenic
995985165 5:118162251-118162273 GAAATGGGCATTGGGCTCTGAGG + Intergenic
996384649 5:122898476-122898498 GCCATGTGCCTTTGGGTCAGAGG + Intronic
996611198 5:125382492-125382514 GTCCTGGGCATTGAGCTCTGAGG - Intergenic
996815206 5:127566620-127566642 GCTCTGGGCTCTGGGCTCTGGGG - Intergenic
997351789 5:133236268-133236290 GAGATGGGCCCTGGGCTCTGAGG + Intronic
997591448 5:135075583-135075605 TCCATGGAACTTGTGCTCTGAGG + Intronic
998092539 5:139379748-139379770 GCCATAGGCTTTTGGGTCTGTGG + Exonic
998511528 5:142718307-142718329 GCCCTGGGCCGAAGGCTCTGAGG + Intergenic
998848112 5:146330626-146330648 GACATGGGCCTTGGAATATGAGG + Intronic
999629971 5:153560767-153560789 GCTATGGGCCTTTGGTTTTGAGG + Intronic
999906076 5:156142656-156142678 GCCCTTGTCCTTGGGATCTGTGG + Intronic
1001399271 5:171437141-171437163 GCCTTGGGCCTGGGGATCTGGGG + Intronic
1001424239 5:171613039-171613061 GCCATTGACCTTGGAGTCTGTGG - Intergenic
1001629730 5:173165760-173165782 CCCCTGGGCCCTGGGCACTGAGG + Intergenic
1001705755 5:173740106-173740128 GCTATGGCCCTTGAGGTCTGTGG + Intergenic
1006078164 6:31547645-31547667 GCCTTGGGCCTACGGCTCTGGGG + Exonic
1006561599 6:34917729-34917751 GCCATAGGCCTTCGGGTCTTAGG - Intronic
1007216938 6:40247748-40247770 GCCAAGGGCAGTGGGGTCTGAGG - Intergenic
1007581752 6:42964065-42964087 GGCCAGGGCCTTGGGTTCTGGGG - Exonic
1015473649 6:133635016-133635038 GCTGTGGACCATGGGCTCTGAGG - Intergenic
1016182300 6:141162215-141162237 GCCAAGGCCCTTGGCCCCTGGGG + Intergenic
1018652379 6:166003035-166003057 GTCCTGGGCCTTGGCCTGTGTGG - Intergenic
1018950939 6:168378525-168378547 TACATGGGACTTGGGCTGTGTGG - Intergenic
1018951125 6:168379476-168379498 TGCATGGGACTTTGGCTCTGTGG - Intergenic
1019210668 6:170402009-170402031 TCCCTGCGCCCTGGGCTCTGTGG + Intronic
1019406374 7:886233-886255 GCCCTGGGCCTCGGCCACTGGGG + Intronic
1019738236 7:2660744-2660766 GGGATGGGCCTGGGGCCCTGGGG + Intronic
1019892277 7:3955951-3955973 GCCATGGGCTCTGGGCCATGTGG + Intronic
1021254632 7:18375720-18375742 GCCCTGCCCCTAGGGCTCTGAGG + Intronic
1022611985 7:31885053-31885075 ACCATGGGACCTGGCCTCTGAGG - Intronic
1026079610 7:67205907-67205929 GCTAGGGGCCTTGGGATCTGAGG - Intronic
1026403140 7:70036675-70036697 GCCTTGGGCCTGTGGGTCTGTGG + Intronic
1026697238 7:72606075-72606097 GCTAGGGGCCTTGGGATCTGAGG + Intronic
1027996103 7:85427122-85427144 GCCATGGGCCTTGTGCTCTAAGG + Intergenic
1028845083 7:95471282-95471304 GCAATGGCCCTGGAGCTCTGGGG - Intergenic
1032079902 7:128853662-128853684 GCCAGGAGGCTGGGGCTCTGAGG + Intronic
1032708988 7:134446436-134446458 GCCATGGGCCTGGGGCTCTTGGG - Intronic
1034197141 7:149256660-149256682 GCCTTGGGCCTTGTGTTGTGGGG + Intergenic
1034421637 7:150993861-150993883 GGGCTGGGCCTTGGGCTGTGCGG + Exonic
1034976106 7:155450030-155450052 GCCCGGGGCGTTGGGCGCTGCGG + Intergenic
1035370828 7:158377867-158377889 GCCACGGGCCCTGTGCTGTGTGG - Intronic
1035658147 8:1326976-1326998 GACACAGGCCTTGGGCTATGAGG + Intergenic
1036581585 8:10080466-10080488 CACATGGGCCTTGTGCTTTGTGG + Intronic
1036754762 8:11464830-11464852 CTCATTGGCCTGGGGCTCTGTGG + Intronic
1038491364 8:27974188-27974210 AGCATGGGTCTGGGGCTCTGTGG + Intronic
1039153566 8:34530205-34530227 GCCGTGGGCCGTGGGCCATGGGG + Intergenic
1039436147 8:37560695-37560717 GCCATGGGGCTGGAACTCTGCGG - Intergenic
1039972604 8:42333155-42333177 TCCCTGGACCTTGGGATCTGAGG + Intergenic
1040915679 8:52565014-52565036 GCCCTGCGCCTGGGGCTCCGTGG - Intronic
1047301077 8:123613856-123613878 TCTTTGGGCCCTGGGCTCTGGGG - Intergenic
1048046541 8:130778229-130778251 GAGATGGGCCTTATGCTCTGGGG + Intergenic
1048810054 8:138277394-138277416 CCCATTGGCCTGGGACTCTGAGG - Intronic
1049255447 8:141611290-141611312 TCCAGGGGCCGTTGGCTCTGGGG + Intergenic
1049513621 8:143042444-143042466 GCCATGAGCCTGGCACTCTGTGG + Intronic
1049844165 8:144792110-144792132 GCCATGGGCCGTGTGATCCGTGG - Exonic
1052768857 9:32669045-32669067 GCCATGGGCCTTGGCTTGTCTGG + Intergenic
1052846223 9:33338854-33338876 TCTAGGGGTCTTGGGCTCTGGGG - Intronic
1053147908 9:35724353-35724375 GCCATGGGGGTTTGGCACTGAGG - Intronic
1053450729 9:38192168-38192190 GCCATTGTCCTTGGGCCCAGTGG + Intergenic
1054743582 9:68832601-68832623 AAGATGGGCCGTGGGCTCTGTGG + Intronic
1054816849 9:69483820-69483842 GCCAGGGGCTGTGGGGTCTGGGG - Intronic
1054837944 9:69699491-69699513 GCCTGGGGCCTGGGGCTATGGGG + Intergenic
1055885565 9:81059615-81059637 GCAATGGACATTGGGCTGTGGGG + Intergenic
1056235693 9:84591749-84591771 GAGATGGGCCTTGGGCTGTCTGG + Intergenic
1056896426 9:90554898-90554920 GCCCTGTGCTTTGGGCACTGAGG + Intergenic
1057172055 9:92968961-92968983 GCCCTGGGCCTTGCTCACTGTGG + Intronic
1057429443 9:94980339-94980361 GTCATGGGCCTTGGCATCTGGGG + Intronic
1060821002 9:126661623-126661645 ACCAGGAGCCTGGGGCTCTGTGG + Intronic
1061090692 9:128424338-128424360 GCCTGAGGCCTTGGGGTCTGTGG + Intronic
1061800809 9:133112627-133112649 CCCATGGGCCTCTGGCCCTGGGG - Intronic
1061934737 9:133851090-133851112 GTCATGCCCCTGGGGCTCTGCGG + Intronic
1062020931 9:134319155-134319177 GACATGGGGCTGGGGCCCTGGGG + Intronic
1062044181 9:134417571-134417593 GCCCGGGGCCTGGGGCCCTGCGG + Intronic
1185889886 X:3814602-3814624 GCCCTGTGCCTTGCGCTCAGAGG - Intergenic
1186442338 X:9596962-9596984 ACCATGGGCCATGGGCTTTAGGG - Intronic
1187213547 X:17253156-17253178 GCCATTAGCCTTGGGTTCAGTGG - Intergenic
1187249676 X:17585590-17585612 GGAATGGGCCTTTTGCTCTGAGG + Intronic
1190063811 X:47226917-47226939 GGCATGGGCCCTAGGCGCTGTGG + Intronic
1191883214 X:65863008-65863030 GGGATGGGCCTTGGGGTCTTGGG + Intergenic
1192205071 X:69090191-69090213 GCCATGGACCTTGGGCCATGAGG - Intergenic
1193396576 X:80990778-80990800 GTCATGGACATTGGGCTTTGAGG + Intergenic
1195668325 X:107449844-107449866 GGCATGGGCTTGGGGCTCAGTGG - Intergenic
1195980799 X:110576500-110576522 CCCATGGGCCTTAGGGTCAGAGG + Intergenic
1196439278 X:115703619-115703641 GTCCTTGGCCTTGGGCTCAGCGG - Intergenic
1196457752 X:115902141-115902163 GGCACAGGCCTTGGGCTCTTGGG - Intergenic
1198293009 X:135257046-135257068 GCCATGGGCCTTGGGCTCTGAGG + Intronic
1199037028 X:143063792-143063814 ACCATGGGCCTTGGACTCTGAGG + Intergenic
1202596294 Y:26544251-26544273 GGGATGGGCCTTGGGCCTTGGGG - Intergenic