ID: 1198296075

View in Genome Browser
Species Human (GRCh38)
Location X:135288032-135288054
Sequence TGTTATCTCATATCACTTAA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 210
Summary {0: 1, 1: 0, 2: 1, 3: 11, 4: 197}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1198296075_1198296078 23 Left 1198296075 X:135288032-135288054 CCATTAAGTGATATGAGATAACA 0: 1
1: 0
2: 1
3: 11
4: 197
Right 1198296078 X:135288078-135288100 AGAAAAAGACAAACTGGTTTAGG 0: 1
1: 0
2: 8
3: 78
4: 650
1198296075_1198296076 -2 Left 1198296075 X:135288032-135288054 CCATTAAGTGATATGAGATAACA 0: 1
1: 0
2: 1
3: 11
4: 197
Right 1198296076 X:135288053-135288075 CAAAAAGAAAATTCTAAAAATGG 0: 1
1: 2
2: 30
3: 255
4: 2590
1198296075_1198296077 17 Left 1198296075 X:135288032-135288054 CCATTAAGTGATATGAGATAACA 0: 1
1: 0
2: 1
3: 11
4: 197
Right 1198296077 X:135288072-135288094 ATGGTAAGAAAAAGACAAACTGG 0: 1
1: 0
2: 9
3: 70
4: 747

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1198296075 Original CRISPR TGTTATCTCATATCACTTAA TGG (reversed) Intronic
902714668 1:18264314-18264336 TATTATCTCATTTAATTTAAGGG - Intronic
903493317 1:23745902-23745924 TGTTATCTTGGCTCACTTAAGGG + Intronic
904299486 1:29544927-29544949 TGTTATTTCATACCACTAATGGG - Intergenic
907791112 1:57664755-57664777 TGTTCTTTATTATCACTTAATGG - Intronic
907938168 1:59061302-59061324 TGTTTTCTCAGATCACTCCAGGG - Intergenic
908152582 1:61318462-61318484 TGTGATCTCAATTCACTTTAAGG - Intronic
911884793 1:103284368-103284390 TGTTCTCTCATTACACTCAAGGG - Intergenic
912034026 1:105287943-105287965 TGTTATCTCATAACTATTTATGG - Intergenic
912678082 1:111704745-111704767 CTTTATCGCATATCACTTAGAGG - Intronic
912837903 1:113012784-113012806 TGTTATTCCATATCACTTGCTGG + Intergenic
915017629 1:152750114-152750136 TGTTGTCTCAGTTCAATTAAAGG - Intronic
915912001 1:159921221-159921243 TGTTATCTTATATGACAAAAAGG + Intronic
917262629 1:173186748-173186770 TTTTATCTCATCTCCCTGAAGGG - Exonic
917561577 1:176163184-176163206 TGTTATCTAAATTCATTTAAGGG - Intronic
918054396 1:181006400-181006422 TGCTAGATCATAGCACTTAATGG - Intronic
919351674 1:196464096-196464118 TGTTTTCTCATCTAACTTAAGGG - Intronic
921766450 1:218978184-218978206 TGTTATTTCATATTTCTCAAAGG + Intergenic
922015878 1:221646409-221646431 TGGTATGTCATTTTACTTAATGG - Intergenic
922633926 1:227144661-227144683 TTTAATCTCATATAACCTAAAGG + Intronic
923882129 1:238115176-238115198 GGTTATCTCATATAACCAAAGGG - Intergenic
1065843013 10:29720788-29720810 AGTGATATAATATCACTTAAAGG + Intronic
1066658691 10:37719338-37719360 TATTATCTCACTTCACTTAATGG + Intergenic
1068329327 10:55540643-55540665 TGTTATGTAATATCAATTAAAGG + Intronic
1069101971 10:64333447-64333469 AGTAATCTAATATCAATTAAAGG - Intergenic
1081729950 11:45364389-45364411 TGGTCTCTCATATCTCTGAATGG - Intergenic
1082010370 11:47446391-47446413 TCCTATCTCATCTCACTGAATGG + Intronic
1083144034 11:60744778-60744800 TGTTATTTCATTGTACTTAATGG - Intergenic
1083916707 11:65750086-65750108 GGTTCTTTCATGTCACTTAATGG + Intergenic
1085433636 11:76479878-76479900 AGTGAACTCATGTCACTTAATGG + Intronic
1086752640 11:90517169-90517191 TGTCATCTGATATTACTTATGGG - Intergenic
1086898161 11:92337097-92337119 TGTTATCTAAGCTAACTTAAAGG - Intergenic
1088081751 11:105925184-105925206 TCTTATCTCACATAGCTTAAGGG + Intronic
1088618774 11:111661005-111661027 TGTTATCTAATATGACTTTCAGG + Intronic
1090861531 11:130657448-130657470 AGTTATCTAATATCACTTGAAGG + Intergenic
1096427501 12:51516597-51516619 ACTTTTCTCATATCAATTAATGG - Intergenic
1097043304 12:56169461-56169483 TCTAATCTCATCTCACTTAGAGG - Intronic
1097626415 12:62006944-62006966 TCTTATCTCATAAGACTAAATGG + Intronic
1097920370 12:65066116-65066138 TGACATCTCATATTACATAACGG - Intronic
1098860649 12:75706260-75706282 TGTCATCTCTTATTTCTTAAGGG - Intergenic
1099088983 12:78280624-78280646 TGTTTTCTCATATGACTCATTGG - Intergenic
1099089048 12:78281247-78281269 TGTTTTCTCATATGACTCATTGG + Intergenic
1099787213 12:87281022-87281044 TGATGTGTCATTTCACTTAAGGG - Intergenic
1105653698 13:22409575-22409597 TGTTATCTCATTTTTTTTAATGG - Intergenic
1105751223 13:23423294-23423316 TGCTGTCTCACATCACTGAATGG + Intronic
1106921271 13:34566160-34566182 TGTTTTCTTATATAACTCAAGGG - Intergenic
1107542835 13:41409093-41409115 TGTTCTCTAATTTCACTAAAAGG - Intergenic
1109098563 13:58148587-58148609 TTTTATCTTATATGAATTAATGG + Intergenic
1109114607 13:58365488-58365510 AGTCATCTAATATCACTTTAAGG + Intergenic
1110096445 13:71529010-71529032 TATTATCTGTTATCAATTAAAGG - Intronic
1111177396 13:84613848-84613870 TGCTATCTCTTATCACTCAGAGG - Intergenic
1112191622 13:97183765-97183787 TGTTATCTGATATTAATAAAAGG + Intergenic
1112341944 13:98559826-98559848 TCATATCTCATATCACTGAAAGG + Intronic
1112487426 13:99832817-99832839 TGTTATATCAAATCTGTTAAAGG + Intronic
1114246334 14:20918019-20918041 TGGTATATGATATCATTTAAAGG + Intergenic
1114399806 14:22399605-22399627 TGTTATCCCATGTCCCTGAAGGG - Intergenic
1116582086 14:46654592-46654614 TCTGTTCTCATATCTCTTAATGG - Intergenic
1116608627 14:47036421-47036443 ATTTCCCTCATATCACTTAATGG - Intronic
1117427591 14:55616970-55616992 TGCTTTTTAATATCACTTAAAGG + Intronic
1120565753 14:86054337-86054359 TTTTGTATCATATAACTTAAAGG - Intergenic
1120598291 14:86468507-86468529 TGTTATCTGATTTAACTTTATGG + Intergenic
1121937971 14:98037851-98037873 TCTCTTCTCATATCTCTTAATGG + Intergenic
1126390033 15:48138137-48138159 TTATATCTAATATTACTTAATGG + Exonic
1127013356 15:54655058-54655080 TGTTATTTCATTTCTTTTAATGG - Intergenic
1127741261 15:61908834-61908856 TGTTATCTCAAAACATGTAAGGG + Intronic
1129915201 15:79263922-79263944 ATTTTTCTCATATCAGTTAACGG + Intergenic
1131237239 15:90707201-90707223 TTTAATCTCATCTCATTTAATGG + Intergenic
1131524074 15:93138871-93138893 TGTTGTCTCATATTACTGAGAGG + Intergenic
1131837415 15:96405047-96405069 TGTTATCACATAATACCTAAGGG - Intergenic
1135192182 16:20363694-20363716 TGTTATGTCATGTCATTTATAGG + Intronic
1140651083 16:77089231-77089253 TGTTATCTCATTTAGTTTAATGG - Intergenic
1144887186 17:18471357-18471379 TGTTCTCTCATTTCACATCAGGG + Intergenic
1145145030 17:20472938-20472960 TGTTCTCTCATTTCACATCAGGG - Intergenic
1146353906 17:32118430-32118452 TGTTCTCTCATTTCACATCAGGG + Intergenic
1146898587 17:36564986-36565008 TGTTATGTAAGATCACCTAAAGG + Intronic
1148859005 17:50594282-50594304 TGTTATTTAGTATCAATTAATGG - Intronic
1149585879 17:57786205-57786227 TGTTATCTCACAACCTTTAAAGG - Intergenic
1149730761 17:58943928-58943950 TGTTGTCTCAAATCATTAAATGG + Intronic
1150187243 17:63196127-63196149 TGTAATGTAATATCAGTTAATGG - Intronic
1151204735 17:72497969-72497991 TCTTTTTTCATATCATTTAAGGG - Intergenic
1151303347 17:73245551-73245573 TGGTATCTCATATAGCTGAATGG - Intronic
1152481275 17:80555190-80555212 TCTTATCTAATGTCACTTCAAGG - Intronic
1152897994 17:82924530-82924552 TGTTCTATCATATGACATAAAGG - Intronic
1153933412 18:9899296-9899318 TGTTAACTGGTATGACTTAAAGG - Intergenic
1154257574 18:12797363-12797385 TGTAATCATATAACACTTAAGGG - Intronic
1155486456 18:26348407-26348429 GGTTATCTCATATCTTTGAAAGG + Intronic
1156676851 18:39537507-39537529 TTTTATATGATATTACTTAATGG - Intergenic
1156708170 18:39909188-39909210 AGTTATCTAATATCCCTTCAAGG - Intergenic
1158056193 18:53284185-53284207 TGTTATGTAAGATCACTAAAAGG + Intronic
1158443585 18:57499437-57499459 TTTTATCTCATATTCCATAAAGG - Intergenic
1167941788 19:52952929-52952951 TGTTTTCTCATTTCACGTGAGGG - Intronic
1168430348 19:56274142-56274164 AGTTTTCTCATCTCAGTTAAGGG - Intronic
928058019 2:28078236-28078258 GGTTATATCATATCTCTTTATGG + Intronic
929401010 2:41581729-41581751 TGTGATCTAATATCACCTACAGG - Intergenic
930191709 2:48466575-48466597 GGTGATCTCATACCACTTACTGG - Intronic
930406563 2:50964814-50964836 TGTTTTCTTAAATGACTTAATGG - Intronic
930816334 2:55601763-55601785 TGTTATACCATATCACATTATGG - Intronic
930993418 2:57686558-57686580 TTTTATCTTATATCTCTTGAGGG - Intergenic
931138146 2:59427549-59427571 CATTATCTCATATTTCTTAAAGG - Intergenic
933494756 2:83035622-83035644 TGTTATTTCATATCCATGAATGG - Intergenic
935415386 2:102811311-102811333 TGATATCACACATCACTTGATGG - Intronic
938180949 2:129181789-129181811 TGTGATATAATCTCACTTAAGGG - Intergenic
938590622 2:132732537-132732559 TCTTATCTCATATTACATGAAGG - Intronic
939147256 2:138430805-138430827 TGTTATTTCACAAGACTTAATGG - Intergenic
939839265 2:147167613-147167635 AAATATCTCATATCACTTATTGG - Intergenic
940415620 2:153416746-153416768 TGTTGTATCATATCACATAGAGG - Intergenic
940776617 2:157891549-157891571 TGATATCTAAAATGACTTAAAGG + Intronic
941588382 2:167388184-167388206 AGATATCACATATCCCTTAAAGG + Intergenic
943307551 2:186283446-186283468 GTTTACCTCATGTCACTTAAGGG - Intergenic
944190099 2:196993736-196993758 TGTTAGCCCATGTCACTAAAAGG + Intronic
945960830 2:216133145-216133167 TATTATCTCAGAACAGTTAAGGG + Intronic
946814357 2:223561129-223561151 TGTCATGTCATTTCAATTAATGG - Intergenic
947148442 2:227089717-227089739 TGTAATCACATAGCACTTAATGG + Intronic
1169267038 20:4172932-4172954 TGTTCACCCATGTCACTTAAGGG + Intronic
1169355843 20:4904304-4904326 TGTTATCACATATCACTGCTGGG + Intronic
1169426272 20:5499864-5499886 TCTTAGCTCATCTCATTTAAAGG - Intergenic
1171433077 20:25098549-25098571 GCTTATCTCTCATCACTTAAGGG - Intergenic
1175078554 20:56397341-56397363 TGCTATGTCACATCACATAAAGG + Exonic
1178339334 21:31772741-31772763 TGTTCTCTCATGTGACTGAAAGG - Intergenic
1180411949 22:12620817-12620839 TGTTATTTTGTTTCACTTAAGGG + Intergenic
1182190338 22:28453537-28453559 TTTTATTTTATATCAGTTAATGG + Intronic
949847862 3:8390226-8390248 GGTTCTCTGATATGACTTAAGGG - Intergenic
951124465 3:18967646-18967668 TGTTTCCTCATATCACTTTAGGG + Intergenic
951153072 3:19315465-19315487 TGTTGTTTCATAAAACTTAAAGG + Intronic
951843383 3:27059212-27059234 TGTTAACTCACATAACTGAATGG - Intergenic
954319958 3:49825492-49825514 TGTTATCTCTTATAAAGTAATGG + Intergenic
954486152 3:50853582-50853604 TGTTATTTCATTTCAGATAATGG + Intronic
955207802 3:56912420-56912442 AGTTATCACATAGCACCTAATGG + Intronic
956812982 3:72882373-72882395 TGTTAACTCATATAATCTAAGGG - Intergenic
957951989 3:87139384-87139406 TGTTATTTAATGTCACTTTAGGG + Intergenic
959621129 3:108399559-108399581 TCTTATCTGATATCCCATAAAGG + Intronic
959885072 3:111489797-111489819 TGTAATCTCATATTTCTCAAAGG - Intronic
961183446 3:124894624-124894646 TGTTTTCTCATATCACCTAAAGG + Intronic
961267953 3:125662097-125662119 TGTTGTTTCATATCACAGAATGG - Intergenic
961268045 3:125663567-125663589 TGCTGTTTCATATCACTGAATGG - Intergenic
961268534 3:125669725-125669747 TGGTGTTTCATATCACTGAATGG - Intergenic
962631899 3:137285256-137285278 TGTTATTTATTTTCACTTAAAGG - Intergenic
967542641 3:190685367-190685389 TGGTTTCTCACATCACATAAAGG - Intergenic
970938083 4:21598104-21598126 TGTTCTCTCCTTTCATTTAATGG - Intronic
972153318 4:36123722-36123744 TGTTACTTCTTATCACTTAAAGG + Intronic
974420589 4:61668048-61668070 TGTTATCTTATATGGCTAAAGGG + Intronic
974602884 4:64109177-64109199 TGTTATGTCATATCACTGTCAGG - Intergenic
974668733 4:65000703-65000725 TGTTTTATCATATGATTTAATGG - Intergenic
975028401 4:69581431-69581453 ATTTATTTCATATTACTTAAAGG - Intergenic
976695092 4:87910565-87910587 TGTTATCTTATATCGCAAAAGGG - Intergenic
979353964 4:119680766-119680788 TGTTGTCTGATTTTACTTAAGGG - Intergenic
980689112 4:136269401-136269423 TGTTATCTCATATTCCAAAAGGG + Intergenic
982730530 4:158951202-158951224 TGTAGTCACACATCACTTAACGG + Intronic
982752594 4:159179852-159179874 TGAAATCTCATACCACTTAGAGG + Intronic
983730096 4:170982822-170982844 TGTTATGCCATTTCACATAAGGG + Intergenic
984339138 4:178431504-178431526 TGATATGTCACATCACTGAACGG + Intergenic
984723553 4:182999385-182999407 AATTATTTCATAACACTTAAGGG - Intergenic
984848981 4:184136635-184136657 TGTTTTCTCATATCATTTTGAGG + Intronic
987163796 5:15173046-15173068 TGTTATCAAATATCATTGAAAGG + Intergenic
988242737 5:28634385-28634407 TGATACCTCATATCACTTTCAGG - Intergenic
988608666 5:32704288-32704310 TTTCATTTCATATCACTGAAAGG - Intronic
989691363 5:44148702-44148724 TGTTTTCTGATATAACTCAATGG - Intergenic
995152965 5:108872956-108872978 TGTTATATCATATCACCTGTTGG + Intronic
995331797 5:110954954-110954976 TGTTATCACACATCATTTATGGG + Intergenic
996419330 5:123244404-123244426 AATTATCTCATATCATTTGAAGG - Intergenic
996470660 5:123856352-123856374 TGTTATCTAGTATTACTTAAAGG - Intergenic
998266066 5:140668709-140668731 TGTTGCCTCATATCCATTAAGGG - Exonic
998635310 5:143948243-143948265 TATTATCTCATATTTCTTGAAGG + Intergenic
999049681 5:148509046-148509068 TGTTATCTATTATTATTTAAAGG - Intronic
999519620 5:152337848-152337870 TGTTATCTAATGTCAGGTAAGGG + Intergenic
1004733170 6:18378594-18378616 AGTTTTATCATATCATTTAAGGG - Intergenic
1006764130 6:36489908-36489930 TGTTAAGTCAGATCATTTAATGG + Exonic
1007682370 6:43643415-43643437 TGTTATCTCAAAACAATTTATGG - Intergenic
1009331778 6:62431495-62431517 TATCATCTCACATCAGTTAATGG - Intergenic
1011559377 6:88599289-88599311 AGTTATCCCATAGCACTAAATGG - Intergenic
1012090169 6:94882387-94882409 TGTTCCTTCATATCACTAAATGG + Intergenic
1012493833 6:99812528-99812550 TGTTATTTCAAATCACTAAGTGG + Intergenic
1012744834 6:103072731-103072753 TGTATTCTTATCTCACTTAAAGG - Intergenic
1016083136 6:139879598-139879620 TCTTATCTAATTGCACTTAATGG - Intergenic
1016302538 6:142648150-142648172 TGTTCTTTCATCTCAATTAAGGG + Intergenic
1017266259 6:152449984-152450006 TATAATCTCATATCCCTAAAGGG - Intronic
1019902805 7:4036736-4036758 TGTAATCTCATATGACAGAAGGG - Intronic
1020514741 7:9104279-9104301 AGTGATATAATATCACTTAAGGG - Intergenic
1022609413 7:31854212-31854234 TGCTATCTAATATCACCTGAGGG - Intronic
1030543002 7:110856771-110856793 TGTTATTTCTTATTAATTAAAGG - Intronic
1030761618 7:113358896-113358918 TGTTATCTCATCTAATTTCATGG - Intergenic
1031746372 7:125504488-125504510 TGTTATCTCGTATTACTTTCAGG + Intergenic
1034325553 7:150228409-150228431 TGTTATCTTATATGACAAAAGGG + Intergenic
1036758794 8:11492374-11492396 TCTTATCACAGATCACATAAGGG + Intergenic
1038927922 8:32160540-32160562 TGTTCACTTATTTCACTTAATGG - Intronic
1040127333 8:43752901-43752923 TTTTTTCTCATAGGACTTAAGGG - Intergenic
1041176197 8:55199303-55199325 TGTAATCTGATATCACAGAAAGG - Intronic
1041585720 8:59515640-59515662 TGTTTTCCCATAACACTTTATGG + Intergenic
1044567853 8:93684374-93684396 TGTTATGTGATATCTCTAAATGG - Intergenic
1045115626 8:98977101-98977123 TGTCATCTGATATTACTTATAGG + Intergenic
1046061663 8:109147133-109147155 TGTTATCTCATTTGATTTCATGG - Intergenic
1050914381 9:11112932-11112954 TTTTATCTCACACCAGTTAAAGG + Intergenic
1051569958 9:18544583-18544605 TGCCAGCTCATATCACTCAATGG - Intronic
1053747381 9:41212691-41212713 TGTTATTTCGTTTCACTTAGGGG + Intergenic
1056014000 9:82362947-82362969 TTTTATCTCTTAAAACTTAAAGG - Intergenic
1056212647 9:84379418-84379440 TGTGACCTCATTTCTCTTAAGGG + Intergenic
1056385792 9:86095832-86095854 TGACATCTAATATCACTTCATGG - Intronic
1056972019 9:91213209-91213231 AGCTATCTCAAATTACTTAAAGG + Intergenic
1058314641 9:103549969-103549991 CTTTAGCTCATATCACTTGATGG + Intergenic
1186791768 X:13006617-13006639 TGTTTTCACATATCATTTAAGGG - Intergenic
1187638396 X:21259785-21259807 TGTTTTCTCATGCCATTTAAGGG + Intergenic
1188024769 X:25196564-25196586 TTTTATCTCTTTTCACTTAAGGG + Intergenic
1188694120 X:33167882-33167904 TATTATCATATATCATTTAAAGG + Intronic
1189170226 X:38901819-38901841 TGTAACCTCATATGACTGAAGGG - Intergenic
1193374089 X:80737362-80737384 TGTTATACTATATTACTTAAGGG + Intronic
1193629695 X:83867817-83867839 TGTTATCTTATATGACAAAAGGG - Intronic
1193729352 X:85083809-85083831 TATTATCAGATATCACATAAGGG + Intronic
1195791639 X:108594699-108594721 TGTTATATGATAAAACTTAAAGG - Intronic
1197229746 X:123991334-123991356 TGTTATACCATATTACTTAGTGG - Intronic
1198296075 X:135288032-135288054 TGTTATCTCATATCACTTAATGG - Intronic
1198456684 X:136824197-136824219 TGCTCTCTCTTATAACTTAACGG + Intergenic