ID: 1198296850

View in Genome Browser
Species Human (GRCh38)
Location X:135295680-135295702
Sequence CCCCAAAGGCTGCAACTGGC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 190
Summary {0: 1, 1: 0, 2: 0, 3: 8, 4: 181}

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1198296845_1198296850 -7 Left 1198296845 X:135295664-135295686 CCCTGCTACGCAGCAGCCCCAAA 0: 1
1: 0
2: 0
3: 11
4: 104
Right 1198296850 X:135295680-135295702 CCCCAAAGGCTGCAACTGGCAGG 0: 1
1: 0
2: 0
3: 8
4: 181
1198296846_1198296850 -8 Left 1198296846 X:135295665-135295687 CCTGCTACGCAGCAGCCCCAAAG 0: 1
1: 0
2: 1
3: 12
4: 139
Right 1198296850 X:135295680-135295702 CCCCAAAGGCTGCAACTGGCAGG 0: 1
1: 0
2: 0
3: 8
4: 181
1198296844_1198296850 0 Left 1198296844 X:135295657-135295679 CCTCATTCCCTGCTACGCAGCAG 0: 1
1: 0
2: 1
3: 14
4: 336
Right 1198296850 X:135295680-135295702 CCCCAAAGGCTGCAACTGGCAGG 0: 1
1: 0
2: 0
3: 8
4: 181
1198296843_1198296850 1 Left 1198296843 X:135295656-135295678 CCCTCATTCCCTGCTACGCAGCA 0: 1
1: 0
2: 1
3: 13
4: 402
Right 1198296850 X:135295680-135295702 CCCCAAAGGCTGCAACTGGCAGG 0: 1
1: 0
2: 0
3: 8
4: 181
1198296842_1198296850 4 Left 1198296842 X:135295653-135295675 CCACCCTCATTCCCTGCTACGCA 0: 1
1: 0
2: 1
3: 21
4: 192
Right 1198296850 X:135295680-135295702 CCCCAAAGGCTGCAACTGGCAGG 0: 1
1: 0
2: 0
3: 8
4: 181
1198296839_1198296850 7 Left 1198296839 X:135295650-135295672 CCCCCACCCTCATTCCCTGCTAC 0: 1
1: 0
2: 7
3: 66
4: 651
Right 1198296850 X:135295680-135295702 CCCCAAAGGCTGCAACTGGCAGG 0: 1
1: 0
2: 0
3: 8
4: 181
1198296840_1198296850 6 Left 1198296840 X:135295651-135295673 CCCCACCCTCATTCCCTGCTACG 0: 1
1: 0
2: 1
3: 27
4: 270
Right 1198296850 X:135295680-135295702 CCCCAAAGGCTGCAACTGGCAGG 0: 1
1: 0
2: 0
3: 8
4: 181
1198296841_1198296850 5 Left 1198296841 X:135295652-135295674 CCCACCCTCATTCCCTGCTACGC 0: 1
1: 0
2: 1
3: 23
4: 210
Right 1198296850 X:135295680-135295702 CCCCAAAGGCTGCAACTGGCAGG 0: 1
1: 0
2: 0
3: 8
4: 181

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1198296850 Original CRISPR CCCCAAAGGCTGCAACTGGC AGG Intronic
900152151 1:1183358-1183380 GCCTGAAGGCTGCAGCTGGCTGG - Intronic
900614184 1:3557123-3557145 CCCCAAAAGCTGGAAAAGGCAGG + Intronic
900685216 1:3943992-3944014 CCCCAAAGCCTGGACCGGGCTGG - Intergenic
900767168 1:4513276-4513298 CCCCAAAGGCTGGAAATGTGGGG - Intergenic
901213374 1:7539215-7539237 CCCACATGGCTGCAACAGGCAGG + Intronic
902489144 1:16768164-16768186 CCCCTCAGGCTGGAACAGGCAGG - Intronic
902752822 1:18529146-18529168 TCCCAAATGCTTCACCTGGCTGG - Intergenic
903174658 1:21573771-21573793 CCCCAAAGGCTTCTTCTTGCTGG + Exonic
903996368 1:27307555-27307577 CCCCAGGGGCTGCAGCTGGAGGG - Exonic
912862529 1:113226749-113226771 CCCCAAAGACAGCCACTGTCTGG - Intergenic
913257531 1:116967255-116967277 CGCCAAAGGCTGCCCCTGACAGG - Exonic
915540795 1:156564704-156564726 TCCCAATGGCAGTAACTGGCTGG - Intronic
920358886 1:205398379-205398401 CCCCAAAGGCTGCCACCAGCAGG - Intronic
921185964 1:212669780-212669802 CGGCACAGGCTGCAGCTGGCAGG + Intergenic
921798939 1:219379957-219379979 CCCAAAAGGCAGGAACTGGCTGG + Intergenic
923531293 1:234814361-234814383 CCCCTCAGGCTGGAACAGGCAGG + Intergenic
1062967366 10:1617989-1618011 CCCCTAAGGCTGCATCTCCCCGG + Intronic
1070163551 10:73880980-73881002 CCCCAAACTCTGTAACTCGCAGG + Intergenic
1070189993 10:74103307-74103329 CCCCAAATGCTGTAACTGACTGG + Intronic
1072163428 10:92789160-92789182 CCTCAAACGCTTCAGCTGGCAGG - Intergenic
1072311210 10:94157147-94157169 CACCAAAGGGTGCAAGTTGCAGG + Intronic
1084401652 11:68947364-68947386 CCCCAGAAGCTGGAAGTGGCAGG + Intergenic
1084793590 11:71490146-71490168 CTCCAGAGGCTGGAAATGGCGGG - Intronic
1088409876 11:109522566-109522588 GCCCACAGGCTGCCACTAGCAGG - Intergenic
1089654978 11:119940776-119940798 CTCCAGAGGCTGCAATTAGCTGG - Intergenic
1090260232 11:125314173-125314195 CCCCAAATTCTCCAACTGGAAGG - Intronic
1090836634 11:130458805-130458827 CCCCGCAGGCTGCAACTGCTAGG + Intronic
1091702603 12:2674001-2674023 CCCCAGAGGCTGCATAAGGCAGG + Intronic
1095601316 12:44016266-44016288 ACCCAGAGGCTGGGACTGGCTGG - Intronic
1096407981 12:51357642-51357664 CCCCAGAGGCTGGAAAGGGCAGG + Intronic
1100055319 12:90502473-90502495 CCCCAAATGCTGGAATTTGCTGG + Intergenic
1102530091 12:113539970-113539992 CCCCAAAGCCAACAAGTGGCAGG + Intergenic
1102959625 12:117084400-117084422 CTCCCATGGCAGCAACTGGCTGG - Intronic
1103663252 12:122539247-122539269 CCCCAAAGGCTTCATATGTCTGG - Intronic
1103703722 12:122860562-122860584 CCCAAACTGCTCCAACTGGCAGG - Intronic
1104884067 12:132094605-132094627 GCTCAAAGCCTGCAACTGGCGGG - Intronic
1105489301 13:20872110-20872132 CCCCAAAAGATTCAACAGGCTGG + Intronic
1111572545 13:90106264-90106286 CCCCCAGGGCTCCAACTGGTTGG + Intergenic
1113774774 13:112937530-112937552 CACCAAAGGCTGCAGCTTCCAGG - Intronic
1114552984 14:23544786-23544808 CTGCAAAAGCTGCAGCTGGCAGG - Intronic
1116840731 14:49818779-49818801 CCCCAAATGCTGCAGCAGCCAGG + Intronic
1121521414 14:94588536-94588558 CCCCAGGGTCAGCAACTGGCAGG - Intronic
1122034514 14:98937579-98937601 CCCAAAAAGCAGCAAATGGCAGG - Intergenic
1122217592 14:100214334-100214356 CCCCGAACGCCGCAACTGCCTGG - Intergenic
1122470760 14:101964527-101964549 CCCTAAAGGCAGCCACTGCCAGG - Exonic
1124222569 15:27863111-27863133 CCCCTGAGGCTGCAACTAACTGG + Intronic
1124255264 15:28136400-28136422 CCCCAAAGCCAGCTTCTGGCGGG + Intronic
1124569048 15:30843220-30843242 CCCCAAAGCCAGCTTCTGGCGGG - Intergenic
1127365103 15:58282208-58282230 AGCCATAGGCTGCATCTGGCTGG + Intronic
1127545847 15:59993994-59994016 CCGCAGAGGCTTCAAGTGGCAGG + Intergenic
1128498292 15:68210569-68210591 CTCCGAAGGCTGCAGCTGGGAGG - Intronic
1129167502 15:73787080-73787102 CCCCAAAGCCTGGCACTGGAGGG - Intergenic
1129759026 15:78117680-78117702 CCCCCAAGGCAACAACTAGCTGG + Intronic
1132247281 15:100307340-100307362 CCACAAAAGCTGCAGCTGCCAGG + Intronic
1132575105 16:660538-660560 CCCCAAAGCCTGCACATGGGAGG - Intronic
1132575865 16:663770-663792 CTCCTAAGGCTGCAGCTGGCGGG - Intronic
1132589637 16:721051-721073 CCCCCGAGGCTGCAGCTCGCCGG + Exonic
1132746502 16:1438474-1438496 CCCCGAGGGCTGCAGCTGGATGG - Intronic
1136136012 16:28257389-28257411 CCCCAGAGGCAAGAACTGGCTGG - Intergenic
1138680784 16:58682317-58682339 CCCCAGAGGCTGCTATTAGCTGG + Intronic
1139507997 16:67409178-67409200 TCCCCAAGGCTGTAAGTGGCGGG - Intronic
1141517706 16:84557411-84557433 CCCCAAAGACTGAAACTCACGGG + Intergenic
1142915442 17:3132883-3132905 CACCAAAGGCTGGAATGGGCCGG + Intergenic
1143011697 17:3869601-3869623 CACCCAAGGGTGCAACTGTCGGG + Exonic
1144853735 17:18257080-18257102 CCCCAAAGGCTCCCATGGGCTGG - Intronic
1146302551 17:31700947-31700969 CCCCAAGGGCTGGAACTGTGGGG + Intergenic
1146453593 17:32993272-32993294 CCTCAGAGGCAGCTACTGGCAGG - Intronic
1146530407 17:33603415-33603437 TCCCAGGGGCTGCAACTAGCTGG - Intronic
1147531576 17:41283517-41283539 CCCCAAAGCCTGCAGCTTGTAGG + Intergenic
1147945676 17:44078865-44078887 ATCCAAGGGCTGCAGCTGGCAGG + Exonic
1150170158 17:62986348-62986370 CCCTGAAGGCTGCTCCTGGCAGG - Intergenic
1150456212 17:65308854-65308876 CCCCACAGGCTGCTTCTGGGAGG + Intergenic
1152036676 17:77877753-77877775 CCCCTAAAGCTGCAGCTGTCAGG - Intergenic
1152251652 17:79215678-79215700 CCCCAAAGGCTGTGCATGGCTGG + Intronic
1152302686 17:79504547-79504569 CCCCAGAGGCTGGAAGAGGCAGG - Intronic
1152466464 17:80469526-80469548 GCCCACAAGCTGCCACTGGCCGG - Exonic
1153341273 18:3977633-3977655 CTCCAAAGGCAGCAGCTAGCTGG - Intronic
1155022856 18:21912517-21912539 CCCCACAGGCTGCAGCAGCCAGG - Intergenic
1158481377 18:57824483-57824505 CCACAAAGGCTGCAAATCCCAGG - Intergenic
1159065794 18:63566864-63566886 CCCCAGTGGCTGCAGCTGCCTGG - Exonic
1159124527 18:64207654-64207676 CCCAAAAGTCTGCAAGTGACAGG - Intergenic
1159817495 18:73094131-73094153 AACCAAAGGCTTCAGCTGGCAGG + Intergenic
1161120701 19:2524262-2524284 GCCCAAAGGCAGCATCTCGCAGG - Intronic
1162076936 19:8194172-8194194 CCCCCATGTCTGCAACAGGCTGG - Intronic
1162786214 19:13036586-13036608 CCCCAAGGGCTGCACTCGGCTGG - Intronic
1163603562 19:18262399-18262421 CCCCAAAGGCTTGAGATGGCTGG + Intronic
1165901741 19:39172544-39172566 CCCCGAGGGCTGCAAATGACAGG - Intronic
1166138917 19:40795200-40795222 CCAGAAATCCTGCAACTGGCTGG - Intronic
1167728108 19:51233008-51233030 CCCCATGGGCTACCACTGGCTGG - Intronic
1167980003 19:53267455-53267477 CCCCAAAAGCTGCCATTGTCTGG + Exonic
1167985882 19:53315328-53315350 CCCCAAAAGCTGCCATTGTCTGG - Intergenic
1168266682 19:55227396-55227418 GCCCATAGGCTGCCACCGGCAGG + Exonic
926087058 2:10027215-10027237 CCCCAAAGGCAGCATCAGGTAGG - Intergenic
926114672 2:10204885-10204907 ACCCAAGGTCTGCACCTGGCTGG - Intronic
929579884 2:43075100-43075122 CCCTACAGCCTGCAAGTGGCAGG + Intergenic
931437560 2:62262063-62262085 CCCCAGAGGCTGCAAATGCTTGG - Intergenic
934759019 2:96843279-96843301 CGCCAGAGGCTGCACCAGGCTGG + Intronic
936454864 2:112665355-112665377 CCCCAAAGGCTACAAGTAACGGG - Intergenic
938322841 2:130376653-130376675 TCCCAAAGCCTGAAACTGACGGG - Intergenic
938507540 2:131902222-131902244 CCCCAAACGGAGGAACTGGCTGG - Intergenic
938559573 2:132459898-132459920 TCCCAAAGGCTGTAACTAGCAGG - Intronic
944269061 2:197760456-197760478 CCCCACAGGCTGCCTCTGGTGGG + Intronic
946416914 2:219544283-219544305 CGCCAGAGGCTCCAACTGACTGG - Exonic
948381907 2:237556679-237556701 TCCTAAGGCCTGCAACTGGCTGG - Intergenic
948621288 2:239236310-239236332 TCCCAAAGGCACCAACTGCCTGG - Intronic
1174955220 20:55090429-55090451 CCCCAAAGGCTCCTGGTGGCAGG + Intergenic
1175221578 20:57420495-57420517 CCCCAAAGTCTCCACTTGGCAGG + Intergenic
1175254767 20:57634575-57634597 CCCCTAAGACTGCAGCTGCCAGG - Intergenic
1175812209 20:61864431-61864453 CCCCACAGGCTCCAAGTGGCAGG - Intronic
1178387043 21:32160925-32160947 CTCAAAAGAATGCAACTGGCCGG - Intergenic
1178799839 21:35783100-35783122 AGCCTAAGGCTGCAAATGGCTGG + Intronic
1179956289 21:44740975-44740997 GCTCAAAGGCTGCATGTGGCAGG + Intergenic
1181636646 22:24177775-24177797 CCCCAAAGGCAGCATCTCGGAGG + Exonic
1181910545 22:26234944-26234966 CCCCAACGGCTGATACTGGGAGG + Intronic
1183699903 22:39445412-39445434 CCCCACTGACTGCAGCTGGCAGG - Intergenic
1184438302 22:44493811-44493833 CCCTACAGGCTGGAACTGCCAGG + Exonic
1184477648 22:44730092-44730114 CCCCCAGGGCTGCCCCTGGCGGG + Intronic
950223039 3:11211276-11211298 GCCCAAAGCCAGCAACTGACAGG + Intronic
954451350 3:50573341-50573363 TCCCAAAGTCTGCAGGTGGCAGG - Intronic
954823853 3:53353956-53353978 CCTCAAAAGTTGAAACTGGCTGG - Intergenic
961653902 3:128431015-128431037 CCCACAAGGCAGCCACTGGCAGG - Intergenic
962274701 3:134003240-134003262 CTCCTAGGGCTGCAACTGGTAGG - Intronic
963762764 3:149300756-149300778 CACAAAAGGCTGCAACCTGCAGG - Intergenic
963764802 3:149323495-149323517 CCCCAAATGGTGGGACTGGCTGG + Intronic
966872909 3:184303306-184303328 CCCCAAACCCTGCAACAGGAGGG - Exonic
967157408 3:186706079-186706101 ACACAAGGGCTACAACTGGCTGG - Intergenic
968085388 3:195871859-195871881 CCCCAAAGCTTGAAAATGGCAGG + Intronic
968817990 4:2831630-2831652 CCTCACAGGCTGACACTGGCGGG + Exonic
969604827 4:8197217-8197239 CCCCAGAGGCTGGAGCAGGCAGG + Intronic
972930514 4:44066258-44066280 CCACGAAGGCTCCAACTGACTGG + Intergenic
977548631 4:98415503-98415525 CCCCAAATGGTGGGACTGGCTGG - Intronic
977666598 4:99651729-99651751 GCCCAAAGGAGGCGACTGGCGGG - Exonic
985017132 4:185648219-185648241 CCCAAAATGCTGGGACTGGCTGG + Intronic
985567009 5:624091-624113 CCCGAGAGGCTGCAACTTCCAGG - Intronic
985722998 5:1500635-1500657 CCCCAGGGCCAGCAACTGGCTGG - Intronic
986216498 5:5724395-5724417 CCCCAGATGCTGCAGCAGGCTGG - Intergenic
993626091 5:90226601-90226623 GGCCAAAGGCTGCAACTAACAGG - Intergenic
1000142954 5:158424356-158424378 CCCACAAGGCTGCATCTGCCTGG - Intergenic
1000920488 5:167131540-167131562 CCCCTAAGGAAGCAGCTGGCTGG - Intergenic
1001674056 5:173497886-173497908 CACCACAGGTTGCAAGTGGCCGG + Intergenic
1002414796 5:179114381-179114403 CCCCACAGGGTGCAGCTTGCTGG + Intronic
1004826238 6:19424627-19424649 CTCCTAAGACTGCAACTGCCAGG - Intergenic
1006709539 6:36055183-36055205 CAGCAAAGGATGCAGCTGGCAGG - Intronic
1007431378 6:41779426-41779448 CCCCAAATGCTTCCACTGCCCGG - Intronic
1010585561 6:77654136-77654158 GCCCACAGGCTGAATCTGGCTGG - Intergenic
1014098589 6:117484950-117484972 CCCCAATGCCTGGACCTGGCTGG - Intronic
1019156571 6:170043116-170043138 CACCAAAGGCTGCATCTTCCCGG + Intergenic
1019379448 7:713219-713241 CCCCAGAGGCTCCAAATGCCAGG + Intronic
1019475534 7:1242403-1242425 CCCCACAGGCTGCGCCTGACGGG + Intergenic
1019650905 7:2157773-2157795 CCCCAACACCTCCAACTGGCAGG + Intronic
1019788705 7:2996463-2996485 CACCAAAAGCTGCCACTGCCTGG + Intronic
1022903610 7:34834598-34834620 CACCAAAGGCTGTCACAGGCGGG + Intronic
1022943783 7:35262255-35262277 CCAGAAAAGCTGCAGCTGGCCGG - Intergenic
1026346702 7:69480704-69480726 CTCAAAAGAATGCAACTGGCCGG - Intergenic
1026540478 7:71275774-71275796 CCCCTAAGGCATCAACTGCCTGG + Intronic
1026872430 7:73861210-73861232 CCCAAAAGGCTGGATCTGACTGG - Exonic
1033791020 7:144792345-144792367 CCCCAAAGGTTGCTGCTGGTTGG - Intronic
1036209066 8:6827386-6827408 CCCCTAAGGCTCTGACTGGCAGG + Intronic
1037803031 8:22045295-22045317 GCCCAATGGCTGCCCCTGGCAGG - Intronic
1037931953 8:22886595-22886617 CCCAAAGGGCTGCAAATGGCAGG - Intronic
1038229320 8:25685692-25685714 CCCCAGTGGCAGCAAATGGCAGG - Intergenic
1039088587 8:33804287-33804309 TCCTCAAGGCAGCAACTGGCTGG + Intergenic
1040308251 8:46223413-46223435 CCCCCAGGGCTGTCACTGGCTGG + Intergenic
1040314386 8:46253300-46253322 CCCCTAAGGGTGCCCCTGGCAGG + Intergenic
1040330906 8:46385322-46385344 CCCCCAAGGCTGCCCCGGGCTGG + Intergenic
1041409465 8:57537109-57537131 CCTCTGAGGCTGAAACTGGCAGG - Intergenic
1047249640 8:123172043-123172065 CCCCAAATGATGCAACTAGATGG + Intergenic
1049072324 8:140365625-140365647 CCGCACAGGCTGCAACTGCACGG + Intronic
1051098074 9:13489472-13489494 CCCCAAAGTCTGTAACTCCCAGG - Intergenic
1051574525 9:18599686-18599708 ATCCATAGGCTGCATCTGGCTGG - Intronic
1052793747 9:32902946-32902968 CCCCAAATGCTGCAGATGGTAGG - Intergenic
1054982495 9:71222970-71222992 CCACAAAGGCTGCAACTTCTTGG + Intronic
1056420805 9:86424579-86424601 CCAGAAAGGCTGCAACAGGACGG - Intergenic
1057196267 9:93116909-93116931 CCACAGAGGCTGCAGCTGGTGGG + Intergenic
1057825973 9:98372194-98372216 CCCTGAAGGCTGGAACAGGCTGG + Intronic
1058242047 9:102576387-102576409 CACCAAAGGCTGCATCTCCCTGG - Intergenic
1058949365 9:109889385-109889407 CCCCAAAGCCTGAAAGTGACAGG + Intronic
1060652155 9:125337501-125337523 CACCAATGGCTGCAGCTGGAGGG - Exonic
1060829292 9:126703695-126703717 GCCCAAAGTCTGAGACTGGCAGG - Intergenic
1061945929 9:133908143-133908165 CCCCAAAGAGTGGAACTGGGTGG + Intronic
1062445481 9:136592277-136592299 CCCCCTAGGCTGCAGCTGTCTGG - Intergenic
1187096647 X:16155853-16155875 CACCAACGGCTGCTGCTGGCAGG + Intergenic
1194110141 X:89824031-89824053 CCACAAAGCCTGCAACTCCCAGG + Intergenic
1194953180 X:100151246-100151268 CACCAAAGAATGAAACTGGCTGG - Intergenic
1195877414 X:109556374-109556396 TCACACAGCCTGCAACTGGCAGG - Intergenic
1197870297 X:131057935-131057957 CCCCAAAGGCTGGAATTTGAAGG - Intergenic
1198135252 X:133743213-133743235 TTCCAAAGGCTGCAACATGCTGG + Intronic
1198296850 X:135295680-135295702 CCCCAAAGGCTGCAACTGGCAGG + Intronic
1200064835 X:153499386-153499408 CGCCACAGGCTGCAAAGGGCTGG + Intronic
1200462798 Y:3478772-3478794 CCACAAAGCCTGCAACTCCCAGG + Intergenic