ID: 1198297972

View in Genome Browser
Species Human (GRCh38)
Location X:135305402-135305424
Sequence CTGGCTAGAAGTAGAATTGT AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 610
Summary {0: 3, 1: 0, 2: 4, 3: 72, 4: 531}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1198297968_1198297972 25 Left 1198297968 X:135305354-135305376 CCCACATTTGAACACCTTGTATG 0: 1
1: 2
2: 0
3: 10
4: 149
Right 1198297972 X:135305402-135305424 CTGGCTAGAAGTAGAATTGTAGG 0: 3
1: 0
2: 4
3: 72
4: 531
1198297970_1198297972 11 Left 1198297970 X:135305368-135305390 CCTTGTATGCTAATTTACACTCA 0: 1
1: 0
2: 1
3: 14
4: 130
Right 1198297972 X:135305402-135305424 CTGGCTAGAAGTAGAATTGTAGG 0: 3
1: 0
2: 4
3: 72
4: 531
1198297969_1198297972 24 Left 1198297969 X:135305355-135305377 CCACATTTGAACACCTTGTATGC 0: 1
1: 2
2: 0
3: 13
4: 97
Right 1198297972 X:135305402-135305424 CTGGCTAGAAGTAGAATTGTAGG 0: 3
1: 0
2: 4
3: 72
4: 531

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1198297972 Original CRISPR CTGGCTAGAAGTAGAATTGT AGG Intronic
900153705 1:1194577-1194599 TTTGCTAGATGTAGAATTTTTGG + Intronic
900269870 1:1781551-1781573 CGGGCAAGAAGCAGAATTGGTGG + Intergenic
900480835 1:2898362-2898384 CTGGCGACCAGTAGAGTTGTGGG - Intergenic
901623397 1:10607399-10607421 GCGCCTAGAAGTAGAATTGTTGG + Intronic
901676096 1:10886246-10886268 ATACCTAGGAGTAGAATTGTTGG - Intergenic
901677405 1:10894037-10894059 GTGAATAGAAGTAGAATTATAGG - Intergenic
902064754 1:13675529-13675551 TTATCTAGAAGTAGAATTGCTGG + Intergenic
902105068 1:14028245-14028267 CTGGCAGGAAGTAGAGTTGATGG + Intergenic
902450621 1:16494680-16494702 CTGCCTAGAGGTAGAAGAGTGGG - Intergenic
902502246 1:16918663-16918685 CTGCCTAGAGGTAGAAGAGTGGG + Intronic
902567753 1:17324093-17324115 CTGCCTAGAAGTCAAATTGCTGG + Intronic
903549157 1:24145639-24145661 CTGGGTGGTAGTGGAATTGTAGG + Intergenic
903795448 1:25925571-25925593 ATTTCTAGAAGTAGAATTGATGG + Intergenic
904239066 1:29132333-29132355 CTGGCTGGAAGTGGGACTGTGGG + Intergenic
904970884 1:34418585-34418607 GTGGCTATAAGTAGAATTGATGG - Intergenic
905155843 1:35980602-35980624 TTGGCTAGATGTGGAATTGTTGG + Intronic
905917921 1:41698756-41698778 GTGGCTAGCAGAAGCATTGTGGG - Intronic
907131084 1:52097612-52097634 ATACCTAGAGGTAGAATTGTTGG - Intergenic
907689555 1:56648564-56648586 ATAACTAGAAGTAGAATTGCTGG + Intronic
909225335 1:73013447-73013469 ATACCTAGGAGTAGAATTGTAGG + Intergenic
909699476 1:78506047-78506069 ATGACTAGGAGTGGAATTGTTGG + Intronic
910387112 1:86696561-86696583 ATTGCTATAAGTAGAATTGCTGG + Intergenic
910681251 1:89867623-89867645 CTGCCTAGGAGTGGAATTGAAGG + Intronic
910904677 1:92162815-92162837 ATTTCTAGAAGTAGAATTGCTGG - Intergenic
910938445 1:92506606-92506628 ATGTCTAGAAGTGGAATTGCTGG + Intergenic
911385891 1:97175071-97175093 ATACCTAGAAGTAGAATTGTTGG + Intronic
911436299 1:97863394-97863416 CTTCCTAGAAGTGGAATTGTTGG - Intronic
911671997 1:100618179-100618201 ATGCCTAGCAGTAGAATTGCTGG + Intergenic
913606437 1:120471156-120471178 TTGGCCAGGTGTAGAATTGTAGG - Intergenic
914209995 1:145568978-145569000 TTGGCCAGGTGTAGAATTGTAGG + Intergenic
914268919 1:146061350-146061372 TTGGCCAGGTGTAGAATTGTAGG + Intergenic
914368177 1:146999515-146999537 TTGGCCAGGTGTAGAATTGTAGG - Intergenic
914374153 1:147058244-147058266 TTGGCCAGGTGTAGAATTGTAGG - Intergenic
914484806 1:148098689-148098711 TTGGCCAGGTGTAGAATTGTAGG + Intergenic
914584761 1:149050675-149050697 TTGGCCAGGTGTAGAATTGTAGG + Intergenic
916198267 1:162245508-162245530 ATACCTAGAAGTAGAATGGTTGG - Intronic
916269628 1:162926720-162926742 CTGGGAAGAGATAGAATTGTTGG + Intergenic
916598000 1:166264296-166264318 ATGCCTAGGAGTAGAATTGCTGG + Intergenic
919429084 1:197470793-197470815 CTAGCTAGAAGTAGAGTGGTGGG - Intronic
919668947 1:200321209-200321231 CTGGCTAGACGGGGAATTCTCGG - Intergenic
920664507 1:207952079-207952101 CTGCCTAGGAGTGGAATTGCTGG + Intergenic
921199155 1:212788630-212788652 ATTGCTAGAAGTGAAATTGTTGG - Intronic
921248308 1:213271059-213271081 ATTGCTAGAAGCAGAATTGCTGG - Intronic
921606587 1:217163181-217163203 CTGGCTTAAAGTAAAATTTTAGG - Intergenic
922955909 1:229599791-229599813 ATGTCTAGAAGTGGAATTGCTGG + Intronic
922984852 1:229858235-229858257 CTTCCTTGAAGTAGAATTGCTGG - Intergenic
923212416 1:231815980-231816002 ATGCCTGGAAGTAGAATTGTTGG + Intronic
923294039 1:232575653-232575675 ATGCCCAGAAGTAGAATTGCTGG - Intergenic
923415357 1:233752014-233752036 ATACCGAGAAGTAGAATTGTTGG + Intergenic
923951290 1:238957809-238957831 ATGCATAGAAGTAGAATTGCTGG - Intergenic
924299533 1:242623498-242623520 GTGGCTTGAACTAGATTTGTGGG - Intergenic
924714035 1:246555643-246555665 ACAGCTAGAAGTAGAATTGCAGG - Intronic
1062807868 10:437678-437700 ATGGCTAGAAGCAGAAGTTTTGG + Intronic
1063525641 10:6782297-6782319 ATTGCTAGAACTAGACTTGTGGG - Intergenic
1064045366 10:12009178-12009200 ATTTCTAGAAGTAGAATTCTTGG - Intronic
1064141193 10:12791828-12791850 CTATCTAGAAGTGGAATTGCTGG + Intronic
1064238926 10:13606850-13606872 ATACCTAGAAGTAGAATTGCTGG + Intronic
1064319751 10:14293726-14293748 ATGCCAAGAAGTGGAATTGTTGG - Intronic
1064680211 10:17803925-17803947 ATACCTAGAAGTAGAATTGCTGG + Intergenic
1064972108 10:21076490-21076512 ATGCCCACAAGTAGAATTGTTGG - Intronic
1065069465 10:22007343-22007365 TTCTCTAGAAGTGGAATTGTTGG - Intergenic
1067413537 10:46085831-46085853 ATACCTAGAAGCAGAATTGTGGG + Intergenic
1067569633 10:47361867-47361889 TTGGCAAGAAGTTGAATTCTAGG + Intergenic
1068094074 10:52468687-52468709 ATGCCTAGAAGTGAAATTGTTGG - Intergenic
1068544315 10:58328754-58328776 CTACCTAGAAGTAGAACTGCTGG + Intergenic
1069369806 10:67735787-67735809 ATACCTAGAAGTAGAATTGCTGG - Intergenic
1069970982 10:72168963-72168985 ATTCCTAGAAGTAGGATTGTTGG - Intronic
1070044871 10:72822993-72823015 CTATCTAGGAGTAGAATTGTGGG - Intronic
1070110078 10:73477263-73477285 ATTCCTAGAGGTAGAATTGTGGG - Intronic
1070943487 10:80368349-80368371 ATGCCCAGAAGTAGAATTGCTGG + Intergenic
1071817214 10:89244899-89244921 ATGTCCAGAAGTAGAATTTTTGG - Intronic
1071969074 10:90884277-90884299 ATACCTATAAGTAGAATTGTTGG + Intronic
1072553952 10:96500408-96500430 ATTTCTAGAAGTAGAATTGCTGG - Intronic
1072837687 10:98734363-98734385 ATATCTAGAAGTGGAATTGTTGG + Intronic
1072894278 10:99352398-99352420 TTCTCTAAAAGTAGAATTGTCGG + Intronic
1072937095 10:99723875-99723897 ATATCTAGAAGTAGAATTGCTGG - Intronic
1073012147 10:100369325-100369347 ATACCTAGAAGTAGAATTGCTGG - Intergenic
1073031755 10:100531879-100531901 ATGCCTAGGAGTAGAATTGCTGG + Intronic
1073133521 10:101206195-101206217 CTGGCTATAAGCACAGTTGTAGG + Intergenic
1074611894 10:115029678-115029700 CTGGTCAGATGTGGAATTGTGGG + Intergenic
1075051223 10:119183689-119183711 CTGGCTAGAAGCAGAGAGGTAGG + Intergenic
1076483637 10:130801607-130801629 CTGGCTGGAAATAGGATTTTAGG - Intergenic
1076637494 10:131891868-131891890 CTGGAGGGGAGTAGAATTGTGGG - Intergenic
1078092348 11:8272636-8272658 ATTTCCAGAAGTAGAATTGTTGG - Intergenic
1078788731 11:14522383-14522405 ATTCATAGAAGTAGAATTGTGGG + Intronic
1079089564 11:17471140-17471162 CTGGATAGAAGTAGCCTGGTGGG - Intronic
1079173689 11:18119934-18119956 CTGGCTAGAAGCAGAGAGGTAGG - Intronic
1079192258 11:18289368-18289390 CTGGCTAGAGGAAGCATGGTGGG - Intronic
1079535430 11:21509345-21509367 ATTCCTAGAAGTAGAACTGTTGG - Intronic
1079937471 11:26635516-26635538 CTGCCCAGGAGTAGTATTGTTGG + Intronic
1080155962 11:29111403-29111425 TTGGGTAGAAACAGAATTGTAGG - Intergenic
1080223253 11:29931609-29931631 ATAACCAGAAGTAGAATTGTTGG - Intergenic
1080288908 11:30648743-30648765 TTATCTAGAAGTAGAATTGCTGG + Intergenic
1080856837 11:36119324-36119346 ATACCTAGAAGTGGAATTGTTGG + Intronic
1080880720 11:36317586-36317608 ATGCCTAGGAGTAGAATTGTTGG + Intronic
1080902232 11:36506238-36506260 TTTCCTAGAGGTAGAATTGTTGG + Intronic
1081878387 11:46427000-46427022 CTGGATTGAACTAGAATTCTAGG + Intronic
1083135557 11:60672332-60672354 TTTGCTAGAAGTAGGATTCTTGG + Intergenic
1083440779 11:62674921-62674943 CTGACTATAAGTAGAAAGGTTGG + Intergenic
1083733059 11:64663552-64663574 CTGGCTATAAATAGAGGTGTGGG - Intronic
1084340439 11:68495843-68495865 ATACCTAGGAGTAGAATTGTTGG + Intronic
1084931256 11:72557841-72557863 CTGGCTAAAAGTGGAGTTGGAGG + Intergenic
1085008713 11:73119781-73119803 ATTTCTAGAAGTAGAATTGATGG - Intronic
1085171233 11:74451624-74451646 CTGGGAAGAAGTAGAATTTGTGG - Intergenic
1085601161 11:77857361-77857383 ATGTCTAGATGTAGAAGTGTAGG + Intronic
1085953632 11:81364418-81364440 CTGGATAGAAGAAGATTTGGAGG + Intergenic
1086013091 11:82129615-82129637 TTGGCTACACATAGAATTGTGGG + Intergenic
1086033608 11:82389725-82389747 TTACCTAAAAGTAGAATTGTTGG - Intergenic
1086306834 11:85488733-85488755 CTTGCTAGATATAGAATTATGGG - Intronic
1086435576 11:86777008-86777030 CTTCCCAGAAGTAGAATTGCTGG + Intergenic
1086463323 11:87027879-87027901 AGGCCTAGAAGTATAATTGTTGG + Intergenic
1086527949 11:87751128-87751150 CTTGAAAGAAGTAGAGTTGTAGG + Intergenic
1086766164 11:90698146-90698168 CTGGTTGGAAGTAGAATGCTGGG + Intergenic
1086893639 11:92287557-92287579 CTGTCAAGAAGTAGAGTTGTAGG + Intergenic
1087413554 11:97823611-97823633 ATGCCTAGAAGTGGAATTGCTGG + Intergenic
1087438641 11:98154889-98154911 GTGCCTAGAAGTGGAATTGCTGG + Intergenic
1087671949 11:101117106-101117128 GTTTCTAGAAGTAGAATTGTTGG + Intronic
1087995528 11:104802837-104802859 ATGTCTAGGAGTAGAATTGCTGG - Intergenic
1088308910 11:108439457-108439479 ATGTCTAGAAGTGGAATTGCTGG - Intronic
1088712700 11:112523078-112523100 CTGTCTAGAACTTGAATAGTTGG - Intergenic
1088741481 11:112770890-112770912 ATGCCTAGGAGTGGAATTGTCGG - Intergenic
1090340022 11:126009474-126009496 CTGTCTAGAAGGAGGAATGTGGG + Intronic
1091651659 12:2314829-2314851 ATGCCTAGGAGTAGAATTGCTGG + Intronic
1091905454 12:4183701-4183723 CTGGATAGATATAGAATTCTTGG - Intergenic
1093659591 12:21738636-21738658 ATGGTTAGAAGTTGAATTGCTGG + Intronic
1093776350 12:23079332-23079354 ATGCCTAGGAGTAGAATTCTAGG - Intergenic
1093867225 12:24242841-24242863 ATTACTAGAAGTAGAATTGCTGG - Intergenic
1094282806 12:28759058-28759080 ATGCCTAGGAGTAGAATTGCTGG + Intergenic
1095748220 12:45683054-45683076 ATAGCCAGAAGTAGAATTGGTGG - Intergenic
1095879727 12:47120310-47120332 ATACCTAGAAGTAGAATTGCTGG - Intronic
1096203086 12:49699997-49700019 ATTGCTAGAAGTGGAATTATTGG - Intronic
1096989777 12:55790827-55790849 ATAGCTAGCAGTGGAATTGTGGG - Intronic
1097184040 12:57187153-57187175 CTGGCTGGAAGGCGAAGTGTGGG - Intronic
1097199939 12:57269809-57269831 ATGGCTAGAGGTGGAATAGTTGG + Exonic
1098028301 12:66229266-66229288 ATGTCTAGAAGAAGAAATGTGGG - Intronic
1098214033 12:68196746-68196768 CTTTCTAGAAGCAGGATTGTGGG - Intergenic
1098324714 12:69289683-69289705 AGGGCTAGAGATAGAATTGTGGG + Intergenic
1098363336 12:69676927-69676949 CTGCATAGAAGAAGAATTGTAGG + Exonic
1098798954 12:74928578-74928600 ATGTTCAGAAGTAGAATTGTTGG - Intergenic
1098826398 12:75303003-75303025 ATACTTAGAAGTAGAATTGTTGG - Intronic
1098990545 12:77060766-77060788 CTGGAAAGAAGGAGAGTTGTTGG - Intronic
1099976426 12:89550373-89550395 CTGGCAGGAAATAGAATTATGGG - Intergenic
1100039482 12:90296632-90296654 ATACCTAGAAGTAAAATTGTTGG + Intergenic
1101053697 12:100890401-100890423 CTTCCTAGAAGTAGAATTCTTGG + Intronic
1101860648 12:108479755-108479777 CTGGCTAGAAAGAGAATTTCAGG - Intergenic
1102104312 12:110307441-110307463 CTGGCTAGTAGTTGAATTCCTGG + Intronic
1102654892 12:114474234-114474256 ATGCCTAGAAGTAGAATTGCTGG + Intergenic
1103110007 12:118268282-118268304 CTTTCTAGAAGTAGAATTATTGG + Intronic
1103359284 12:120344264-120344286 ATGCCTAGAAGTGGAATTGTTGG + Intronic
1104772833 12:131374799-131374821 ATTTCTAGAAGTAGAATTGTTGG - Intergenic
1106148057 13:27069584-27069606 GTACCTAGAAGTAGAATTGCTGG - Intronic
1106265011 13:28101671-28101693 ATGGCCAGAAATGGAATTGTTGG - Intergenic
1106373160 13:29157224-29157246 AGGGCTAGAAGTGGAATTGTTGG + Intronic
1106543210 13:30708574-30708596 ATAACTACAAGTAGAATTGTTGG + Intergenic
1106754061 13:32803715-32803737 ATGTCTAGAAGTGGAATTGCTGG - Intergenic
1106997757 13:35507380-35507402 CAGGCTAGAAATAGAAATTTTGG - Intronic
1107067991 13:36237419-36237441 ATGCCTAGAAGTGGAATTGCTGG - Intronic
1107146702 13:37068261-37068283 ATACCTAGAAGTAGAATTGCTGG - Intergenic
1107209023 13:37829624-37829646 ATATCTAGAAGTAGAATTGCTGG - Intronic
1107362170 13:39631258-39631280 TTTGCTAGATGTAGAATTCTTGG + Intergenic
1108130152 13:47290258-47290280 TTGGGTAGAAGTAGAAGTGTGGG + Intergenic
1108161957 13:47650010-47650032 CTTGCTAGAAGTAGTATTGAGGG + Intergenic
1108381160 13:49855718-49855740 ATACCTAGGAGTAGAATTGTTGG - Intergenic
1108572608 13:51766312-51766334 CTGGTTAGAAGTAGAGCGGTGGG - Exonic
1108789385 13:53949326-53949348 GTGGCTAGAAGTAGAATTGCTGG + Intergenic
1108857974 13:54819546-54819568 CGGGCTTGAAGTGGAATTGGGGG + Intergenic
1109365302 13:61347994-61348016 CTGTTTAGAAGTAGAATTTCTGG + Intergenic
1110384984 13:74899777-74899799 ATACCTTGAAGTAGAATTGTTGG - Intergenic
1111194799 13:84860453-84860475 CTGGATAGAAAAAAAATTGTTGG - Intergenic
1111794976 13:92907666-92907688 ATTCCTAGAAGTAGAATTGCTGG - Intergenic
1111906412 13:94260903-94260925 CAGGCTAGAACTAAAATAGTGGG + Intronic
1112180413 13:97073387-97073409 CTGTTTAGTTGTAGAATTGTTGG + Intergenic
1112445167 13:99457767-99457789 ATTCCTAGAAGTAGAATTGGTGG + Intergenic
1113984561 13:114303483-114303505 CTGGTAAGAAGCAGAATTGTCGG + Intronic
1114428439 14:22640104-22640126 CTACCTAGGAGTAGAATTATTGG - Intergenic
1115053023 14:29088330-29088352 ATAGCTAGAAGTAGGATTGCTGG - Intergenic
1117425516 14:55591352-55591374 CTAGCTAGAAATAGAATTGCTGG + Intronic
1117922249 14:60737666-60737688 ATGTCCAGTAGTAGAATTGTTGG + Intronic
1118449923 14:65891407-65891429 CTTTCTAGAAGTGGAATTGCTGG - Intergenic
1118588387 14:67379218-67379240 ATGCCTAGGAGTGGAATTGTTGG + Intronic
1119019112 14:71091386-71091408 ACATCTAGAAGTAGAATTGTTGG - Intronic
1119372017 14:74154523-74154545 CTGGCTAGAAGTAAGAGTCTAGG + Intronic
1119577653 14:75741794-75741816 GTAGCTAGACCTAGAATTGTAGG + Intronic
1120139543 14:80913189-80913211 ATTGCTGGAAGTAGAATTGCAGG - Intronic
1120235600 14:81887323-81887345 ATGCCTAGGAGTAGAATTGCTGG + Intergenic
1120297049 14:82655311-82655333 CTGCCTAGAAGTAAATTTCTAGG + Intergenic
1121107289 14:91289344-91289366 CTGGTTAGAAGTAGATGTTTAGG + Intronic
1121319033 14:92980394-92980416 CTGGCTTGGAGTGGACTTGTTGG - Intronic
1121874145 14:97435435-97435457 CTAGCTAGATGTTCAATTGTTGG - Intergenic
1121914809 14:97828661-97828683 TCTGCTAGAAGTGGAATTGTTGG - Intergenic
1122166632 14:99830003-99830025 CTACCTAGGAGTAGAATTGCCGG + Intronic
1122571576 14:102706571-102706593 TTGGCCAGAAGTAGAATTAGTGG - Intronic
1122805836 14:104256395-104256417 ATGACTAGGAGTAGAATTGCTGG + Intergenic
1123909338 15:24951182-24951204 CTGCTTAGGAGTAGAATTGTAGG + Intronic
1124418560 15:29495055-29495077 ATACCCAGAAGTAGAATTGTTGG + Intronic
1125700382 15:41677459-41677481 ATACCTAGAAGTAGAATTGCTGG + Intronic
1126025613 15:44443411-44443433 ATACCTGGAAGTAGAATTGTTGG + Intronic
1126202910 15:46007991-46008013 GTGCCTAGGAGTAGAATTGCTGG + Intergenic
1127579266 15:60322486-60322508 CTTCCTAGACGTGGAATTGTTGG + Intergenic
1127670115 15:61187143-61187165 CTGGCTCGATGTGGAATAGTTGG - Intronic
1128346430 15:66855543-66855565 ACGCCTAGAAGTGGAATTGTGGG + Intergenic
1128380878 15:67111503-67111525 ATACCTAGAAGTAGAATTATGGG + Intronic
1129365846 15:75053891-75053913 ATCCCTAGAAGTAGAATTGCTGG - Intronic
1130943642 15:88533412-88533434 ATACCCAGAAGTAGAATTGTTGG - Intronic
1131439212 15:92446157-92446179 CTGGCTAGAAGTAAAACAGTGGG + Intronic
1133718608 16:8473098-8473120 CCGGCCAGAAGTGAAATTGTTGG - Intergenic
1134514737 16:14877871-14877893 ATTCCTAGAAGTAGAATTGTTGG - Intronic
1134590381 16:15448184-15448206 CTGGCCGGAAGTAGCATTTTAGG + Intronic
1134702414 16:16276524-16276546 ATTCCTAGAAGTAGAATTGTTGG - Intronic
1134783252 16:16917774-16917796 GTGGCAAGAAGTGGAATTGGAGG + Intergenic
1134965129 16:18435591-18435613 ATTCCTAGAAGTAGAATTGTTGG + Intronic
1134969416 16:18518126-18518148 ATTCCTAGAAGTAGAATTGTTGG + Intronic
1136541571 16:30930305-30930327 CTGGCGAGAAGGAGAACCGTGGG + Exonic
1137289870 16:47044933-47044955 CTGCCTAGGAGTACAATTTTTGG - Intergenic
1137535604 16:49322051-49322073 TTGGCTAGAAGTGGAAATTTGGG + Intergenic
1137740830 16:50771516-50771538 CTCCCTAGGAGTAGAATTGCTGG + Intronic
1137943446 16:52711096-52711118 ATCTCTAGAAGTAGAATTGCAGG - Intergenic
1139742813 16:69050089-69050111 ATACCTAGAAGTGGAATTGTTGG + Intronic
1139907250 16:70374849-70374871 ATTCCTGGAAGTAGAATTGTTGG + Intergenic
1141260296 16:82447301-82447323 ATGTCTAGGAGTAGAATTTTTGG + Intergenic
1143566268 17:7722887-7722909 CTACCTAGAAGTGGAATTGCTGG + Intronic
1143752691 17:9041685-9041707 CTACCTAGCAGTGGAATTGTTGG + Intronic
1143808319 17:9449124-9449146 CTGCCTAGGAGTAGGATTGCTGG - Intronic
1143912767 17:10265568-10265590 ATGGTTAGAAGCAGAATTGGGGG - Intergenic
1144159174 17:12540602-12540624 ATACCTAGAAGTAGAATTCTAGG + Intergenic
1144297663 17:13892915-13892937 TTTGCTAGGTGTAGAATTGTAGG + Intergenic
1144707942 17:17381940-17381962 ATGCCTAGAAGTAGAATTACTGG + Intergenic
1145094447 17:20013213-20013235 ATACCCAGAAGTAGAATTGTTGG + Intronic
1146754754 17:35419752-35419774 CTAAGTAGGAGTAGAATTGTTGG - Intronic
1146801557 17:35827798-35827820 CTGGCTAGAAGAAGAATTCCCGG + Intronic
1147876587 17:43625800-43625822 ATGCCTAGAAGAGGAATTGTTGG - Intergenic
1148125455 17:45234248-45234270 CTGGCTAGATGCAGCAGTGTGGG - Intronic
1148126032 17:45237456-45237478 CTGGCTAGGAGGAGCATAGTGGG - Intronic
1148126140 17:45237966-45237988 CTTGCAAGAAGTAGATGTGTGGG + Intronic
1148281325 17:46349812-46349834 ATGCCTAGAAGTGGAATTGCTGG - Intronic
1148303553 17:46567747-46567769 ATGCCTAGAAGTGGAATTGCTGG - Intronic
1149130350 17:53293113-53293135 CTACCTAGAAGTACAATTGCTGG - Intergenic
1149259944 17:54868928-54868950 CTACCTAGAAGTGGAATAGTTGG - Intergenic
1150035972 17:61798024-61798046 CTTTTTAGAAGTGGAATTGTTGG - Intronic
1150063256 17:62086909-62086931 GTATCTAGGAGTAGAATTGTTGG - Intergenic
1150381219 17:64721424-64721446 ATAGCCAGAAGTGGAATTGTTGG - Intergenic
1150742183 17:67788225-67788247 CTAGCAAGAAATAGAATTGGAGG - Intergenic
1151071555 17:71219147-71219169 ATGCCCAGAAGTACAATTGTTGG - Intergenic
1151217266 17:72585651-72585673 ATACCTAGAAGTGGAATTGTTGG - Intergenic
1151339820 17:73463871-73463893 GTGCCTAGAAATGGAATTGTGGG + Intronic
1151393933 17:73807362-73807384 ATATGTAGAAGTAGAATTGTTGG - Intergenic
1153327001 18:3830848-3830870 CTGCTTAGAACTAGAATTATAGG - Intronic
1153733948 18:8044983-8045005 CTAGCTAGAAGTAGAATTACTGG - Intronic
1153853734 18:9123872-9123894 TTTACAAGAAGTAGAATTGTAGG + Intronic
1154115844 18:11612968-11612990 ATGTCTAGAAGTGGAATTGCTGG + Intergenic
1154120288 18:11647191-11647213 ATGTCTAGAAGTGGAATTGCTGG + Intergenic
1155020574 18:21893106-21893128 ATAACTAGAAGTGGAATTGTTGG + Intergenic
1155045670 18:22101005-22101027 CTGATTAGAAATAGAAGTGTGGG - Intergenic
1155422842 18:25674097-25674119 ATGGCTAGGAGCAGAATTGCTGG + Intergenic
1155477108 18:26245999-26246021 ATTGCTAGAAGTGGAATTGTTGG + Intronic
1155525184 18:26708919-26708941 ATGCCAAGAAGTAGAATTGCTGG + Intergenic
1156245983 18:35298756-35298778 ATATCTAGAAGTAGAATTGCTGG + Intergenic
1156293223 18:35767673-35767695 ATAGCTTGAAGTAGAATTGCTGG + Intergenic
1157073856 18:44442758-44442780 GTATCCAGAAGTAGAATTGTTGG - Intergenic
1157400573 18:47383201-47383223 CTGGCTATAAGAAAAATTCTAGG - Intergenic
1157448948 18:47771422-47771444 CTGGTCAGAAATAGAATTGTTGG - Intergenic
1157474571 18:48013081-48013103 ATAGCTAGGAGTAGAATTGTGGG + Intergenic
1158034661 18:53012167-53012189 ATACCTAGAAGTAGAATTGCTGG - Intronic
1158227882 18:55219261-55219283 CTGTAAAGAAGTAGACTTGTAGG - Intergenic
1159120379 18:64162333-64162355 TTGGCTAGAAGGAAAATTGCTGG + Intergenic
1159386607 18:67734139-67734161 ATTGCTAGAAATAGAAGTGTAGG + Intergenic
1159393051 18:67819824-67819846 TTGGCTGGATGTAGAATTCTTGG + Intergenic
1160310250 18:77782871-77782893 ATGCCTAGAAGTAGAATTGCTGG + Intergenic
1160397611 18:78583767-78583789 CTGGGTTGAAGTGGACTTGTAGG - Intergenic
1162970581 19:14178806-14178828 CTGGCTAAAAGGAGAAATTTGGG + Intronic
1163077443 19:14907227-14907249 ATGCCCAGTAGTAGAATTGTTGG - Intergenic
1164471011 19:28532529-28532551 ATACCTAGAAGTAGAATTGTTGG - Intergenic
1164820393 19:31245907-31245929 CTGCAGAGAAGTAGGATTGTTGG - Intergenic
1165584393 19:36901004-36901026 CTACCTAGGAGTAGAATTGCTGG - Intronic
1166358302 19:42240403-42240425 CTTCCTAGAAGTAGAAATTTGGG - Intronic
1166437816 19:42784370-42784392 ATGTCCAGAAGTAGAATTGCTGG - Intronic
1166456764 19:42948162-42948184 ATGTCCAGAAGTAGAATTGCTGG - Intronic
1166466719 19:43039031-43039053 ATGTCCAGAAGTAGAATTGCTGG - Intronic
1166472849 19:43095112-43095134 ATGTCCAGAAGTAGAATTGCTGG - Intronic
1166991874 19:46697570-46697592 GGGGCTAGAATTAGAAGTGTGGG - Intronic
1168143724 19:54407174-54407196 TTGGGTAAAAGTAGAATTGTTGG + Intergenic
1168285202 19:55328203-55328225 CTACCTAGAAGTAGAATTACTGG + Intronic
1168564188 19:57409317-57409339 ATATCTAGAAATAGAATTGTAGG + Intronic
925145402 2:1579921-1579943 CTGCCTAGAAGTGGAGTTGCTGG - Intergenic
927568548 2:24137292-24137314 TTGGGTAGGAGTGGAATTGTTGG + Intronic
927619751 2:24641609-24641631 TTTGCTGGATGTAGAATTGTGGG + Intronic
929634440 2:43503192-43503214 ATACCTAGAAGTAGAATTGCAGG - Intronic
929872131 2:45768040-45768062 CTGGTGAGAAGCAAAATTGTTGG + Intronic
929964872 2:46526888-46526910 ATGCCTAGAAGTAGAATTGCTGG + Intronic
930078846 2:47431024-47431046 CAGGCTAATAATAGAATTGTTGG + Intronic
930520806 2:52464703-52464725 ATATCTAGAAGTAGAACTGTTGG - Intergenic
931556090 2:63507379-63507401 TTGGCTAGATATAGAATTATAGG - Intronic
931886039 2:66618449-66618471 CTGCCTAGGAGTAGAATTTCTGG - Intergenic
931990945 2:67789572-67789594 ATTGCTAGATATAGAATTGTTGG + Intergenic
932193789 2:69765238-69765260 ATACCTAGAAGTGGAATTGTTGG + Intronic
932602906 2:73141980-73142002 TTGGCTGGATGTAAAATTGTAGG + Intronic
932918320 2:75880651-75880673 CTTGCTAGAAGTAGAAATGTTGG - Intergenic
934091344 2:88553268-88553290 GTTGTTAGAAGTAGAGTTGTTGG + Intergenic
935163952 2:100553433-100553455 ATGCCTAGAAGTGGAATTGTTGG - Intergenic
935211526 2:100943064-100943086 CTGACTAGATGTAGAATGGCTGG + Intronic
935362631 2:102260316-102260338 ATGCCTAGAAGTAGAACTGCAGG - Intergenic
935517753 2:104064023-104064045 CTACCTAGAAGTGGAATTGCTGG - Intergenic
936930950 2:117788208-117788230 CTGGCCAGAGATAGAAATGTGGG - Intergenic
937171426 2:119874306-119874328 ATGCCTAGGAGTAGTATTGTTGG - Intronic
937202227 2:120211087-120211109 GTGGGTAGACCTAGAATTGTTGG - Intergenic
937257141 2:120563620-120563642 TTGGCTAGAAGGAGAGTTCTAGG + Intergenic
937629370 2:124082662-124082684 GTGTCAAGAAGTACAATTGTTGG + Intronic
937712076 2:124989531-124989553 GTTCCTAGAAGTGGAATTGTAGG - Intergenic
938450025 2:131409882-131409904 ATACCTAGGAGTAGAATTGTTGG - Intergenic
938811553 2:134858011-134858033 ATAGCCAGAAGTAGAATTGCTGG - Intronic
938983461 2:136549076-136549098 ATACCTAGGAGTAGAATTGTTGG + Intergenic
938985754 2:136574045-136574067 ATGCCTAGGAGTAGAATTGCTGG + Intergenic
939071096 2:137544094-137544116 ATACCTAGAAGTAGAATTGCTGG - Intronic
939881604 2:147637724-147637746 ATTCCTAGAAGTAGAATTGCTGG - Intergenic
939990076 2:148869647-148869669 ATACCTAGAAGTAGAATTGCTGG + Intergenic
940137197 2:150451359-150451381 ATAACTAGAAGTAGAATTGCTGG + Intergenic
940219143 2:151333359-151333381 ATTCCTAGAAGTAGAGTTGTAGG - Intergenic
940549423 2:155134054-155134076 ATAGCTAGAAGTGGAATTGTTGG - Intergenic
940804404 2:158169913-158169935 CTATCTAGCAGTAGAATTGCTGG + Intergenic
940880201 2:158939112-158939134 ATGGCTAGGAGTAGAAATATTGG - Intergenic
940976967 2:159957213-159957235 CTGGGAAGAAGTAGAAATGAAGG + Intronic
941312351 2:163949944-163949966 CTTGCTAAAAATAAAATTGTGGG + Intergenic
941837621 2:170042744-170042766 ATAGCTAGAAGTGGAATTGCTGG + Intronic
942442227 2:176048474-176048496 ATACCTAGAAGTGGAATTGTTGG - Intergenic
942873992 2:180769985-180770007 CGTCCTACAAGTAGAATTGTTGG + Intergenic
943048707 2:182890020-182890042 ATGGCCAGAAGTGGAATTGCTGG + Intergenic
943631161 2:190253957-190253979 CTGGAAAGAAGCAGAATTGGGGG - Intronic
943998271 2:194798727-194798749 CTGACTAGAAGTGGAATTGATGG - Intergenic
944303345 2:198150484-198150506 ATTTCTAGAAGTGGAATTGTTGG + Intronic
944387032 2:199178900-199178922 ATAGCTGGAAGTAGAATGGTTGG - Intergenic
944976458 2:205058450-205058472 ATGTCCAGAAGTAGAATTATTGG + Intronic
945048734 2:205803768-205803790 ATACCTAGAAGTGGAATTGTTGG - Intergenic
945177423 2:207056789-207056811 ATTCCTAGAAGTAGAATTGATGG - Intergenic
945240248 2:207670013-207670035 GTAGCTAGAAGTAGAATTGCTGG + Intergenic
945944444 2:215981135-215981157 ATACCTAGAAGTGGAATTGTTGG - Intronic
946471081 2:219961711-219961733 ATACCTAGAAGTAGAATTGCTGG + Intergenic
947292253 2:228588930-228588952 GTGTCCAGAAGCAGAATTGTTGG + Intergenic
947814475 2:233026898-233026920 CTGCCTAGGAGTGGAATTGCTGG - Intergenic
948069673 2:235110139-235110161 TTGCCCGGAAGTAGAATTGTTGG - Intergenic
1168749469 20:272234-272256 TTGGCTGGAAGTAGAAATTTAGG - Intronic
1170114408 20:12841264-12841286 ATACCTAGAAGTAGAATTGCTGG + Intergenic
1170315323 20:15034965-15034987 ATGTCTAGAAGTAGAATTGCTGG + Intronic
1172714393 20:36951904-36951926 GTGGCTAGAAGCAGAACTGAGGG + Intergenic
1172931561 20:38589759-38589781 CTGGATAGAAGCACACTTGTGGG - Intergenic
1173675505 20:44831490-44831512 ATCCCTAGAAGTAGAATTGCGGG - Intergenic
1173964782 20:47103951-47103973 ATGCCTAGGAGTAGAATTGCTGG + Intronic
1174973048 20:55299489-55299511 ATGTCTAGGAGTAGAATTGGTGG - Intergenic
1176979905 21:15369559-15369581 ATGGCTAGGAGTGGAATTGCTGG + Intergenic
1177081261 21:16641331-16641353 CTGGCCAGCAGTAAAATTGATGG + Intergenic
1178091353 21:29166916-29166938 GTTCCTAGCAGTAGAATTGTTGG + Intronic
1178880850 21:36449006-36449028 ATTCCTAGGAGTAGAATTGTGGG + Intergenic
1180974329 22:19838797-19838819 ATATCTAGGAGTAGAATTGTTGG - Intronic
1181723579 22:24795192-24795214 ATAACTAGAAGTAGAATTGCTGG - Intergenic
1183897288 22:40979443-40979465 ATATCGAGAAGTAGAATTGTTGG + Intergenic
949165544 3:936532-936554 ATGTCCAGAAATAGAATTGTGGG - Intergenic
949372462 3:3350166-3350188 ATACCTAGGAGTAGAATTGTTGG + Intergenic
949891211 3:8734686-8734708 CTGGCTGGAAGTTGGATTGAAGG - Intronic
949902503 3:8828943-8828965 ATAGCTAGGAGTAGAATTGCTGG - Intronic
950182408 3:10924965-10924987 CTACCTAGAAGTGGAATTGCTGG - Intronic
950427677 3:12933230-12933252 ATGGCTGGAAGTGGAATTGCTGG - Intronic
950862953 3:16166493-16166515 CTGGCTGAAAGTAGGATTGAAGG - Intergenic
952049337 3:29364035-29364057 CTTCCTAGAAGTAGAAATATTGG - Intronic
953321323 3:41974569-41974591 CTTCCTAGAAGTGGAATTGCTGG - Intergenic
953447676 3:42981344-42981366 CTGGCTAGAAGCAGCATGGGAGG + Intronic
953850285 3:46461281-46461303 ATGCCTAGAAGTGCAATTGTTGG - Intronic
954953547 3:54496162-54496184 ATAGCTAGAAGTGGAATTGCTGG + Intronic
954998879 3:54908068-54908090 ATACCTAAAAGTAGAATTGTTGG + Intronic
956145256 3:66185461-66185483 ATACCTAGAAGTAGAATTGCTGG + Intronic
956235595 3:67067622-67067644 ATAGCTAGAAGTAGAATTACTGG - Intergenic
956600926 3:71021549-71021571 CTACCTAGAAGTTGAATTGCTGG + Intronic
959383156 3:105667056-105667078 CTAGCTTAAAGGAGAATTGTTGG - Intronic
959656046 3:108806047-108806069 CTGGCTGGAACTAGATTTCTGGG + Intergenic
959818092 3:110700134-110700156 TAGCCTAGAAGTAAAATTGTTGG + Intergenic
960231823 3:115237423-115237445 ATATCTAGTAGTAGAATTGTTGG + Intergenic
960504211 3:118473193-118473215 GTGGTCAGAATTAGAATTGTTGG - Intergenic
960980001 3:123214936-123214958 CTGGCTGGAGGTAGCAGTGTAGG - Intronic
961310211 3:125992669-125992691 ATGCCCAGAAGTAGAATTGCTGG - Intergenic
961366133 3:126400819-126400841 ATATCTAGAAGTAGAATTGCTGG - Intronic
961863891 3:129939630-129939652 CTGCCTAGAAGCAGAATTTCTGG + Intergenic
962153302 3:132916209-132916231 ATGCCTAGAAGTAGATTTTTTGG + Intergenic
962744393 3:138386923-138386945 ATACCTAGAAGTAGAATTGCTGG + Intronic
962762842 3:138532823-138532845 ATTGCTAGAGGTAGAATTGTTGG - Intronic
963198151 3:142557021-142557043 CTACCTAGGAGTAGTATTGTTGG - Intronic
963334616 3:143959602-143959624 TTCTCTAGAAGTAAAATTGTAGG - Intergenic
963809394 3:149760124-149760146 GTATCTAGGAGTAGAATTGTTGG - Intergenic
965594608 3:170398580-170398602 ATACCTAGGAGTAGAATTGTTGG + Intergenic
965778105 3:172255159-172255181 CTGGCTTAAAGAAGAAATGTAGG - Intronic
966078118 3:175963848-175963870 CTGGCAAGATGTAGAATGATTGG + Intergenic
966963388 3:184964946-184964968 ATACCCAGAAGTAGAATTGTTGG + Intronic
967349188 3:188493183-188493205 TTGGCTATAAGTAGAATTCTCGG + Intronic
967680355 3:192355137-192355159 TTACCTAGAAGTAGAATTGCTGG - Intronic
969340904 4:6540585-6540607 ATGCCTAGGAGTAGAATTGCTGG + Intronic
969557380 4:7921658-7921680 ATTGCTAGAAATGGAATTGTAGG - Intronic
970386025 4:15557749-15557771 CTGCATACAATTAGAATTGTAGG + Intronic
970643968 4:18098200-18098222 ATACCTAGAAGTAGAATTGATGG - Intergenic
971745203 4:30570742-30570764 ATACCTAGAAGTAGAATTGCTGG - Intergenic
972690019 4:41388132-41388154 CTACCTAAAAGTAGAATTGCTGG - Intronic
973919121 4:55666788-55666810 CTGGCTTGATATAGAATTGAAGG - Intergenic
974660056 4:64875571-64875593 ATGGCTAGAAGTAGAAGTTGCGG + Intergenic
974662726 4:64915046-64915068 ATGTCTAGCAGTAGAATGGTTGG + Intergenic
974796917 4:66764986-66765008 ATATCTAGAAGTGGAATTGTTGG + Intergenic
974800976 4:66817698-66817720 ACTGCTAGGAGTAGAATTGTTGG + Intergenic
974871649 4:67651561-67651583 TTGGCTAGATGTAAAATTCTGGG - Intronic
974968327 4:68793016-68793038 ATGCCTAGAAGTAACATTGTTGG - Intergenic
975768460 4:77694686-77694708 ATGCCTAGAAGTGGAATTGTTGG - Intergenic
976537149 4:86231351-86231373 CTATATAGAAGTACAATTGTAGG + Intronic
976726436 4:88220321-88220343 ATATCTAGAAGTGGAATTGTGGG + Intronic
976768375 4:88622495-88622517 GTACCTAGAAGTGGAATTGTTGG + Intronic
976800427 4:88984917-88984939 ATAACTAGGAGTAGAATTGTTGG - Intronic
977165315 4:93687400-93687422 CTGGCTAGAAATATAAATGTAGG + Intronic
977345983 4:95816749-95816771 CTGGCTACCAGCAGAATTTTAGG + Intergenic
977367256 4:96085999-96086021 GTGCCCAGAAGTACAATTGTTGG - Intergenic
977800280 4:101220938-101220960 GTGGCTAGAAACAGAATAGTTGG - Intronic
978138918 4:105295800-105295822 ATACCTAGAAGTAGAATTGCTGG - Intergenic
978266590 4:106834111-106834133 ATACCTAGAGGTAGAATTGTAGG - Intergenic
978286196 4:107080248-107080270 ACTGCTAGAAGTAGAATGGTAGG - Intronic
980120488 4:128723095-128723117 CTGGGCAGACGTAGAACTGTAGG + Intergenic
980312247 4:131146528-131146550 ATTGCTAGAAGTAGAATTGTTGG + Intergenic
980438185 4:132808342-132808364 ATATCTAGAAGTAGGATTGTTGG - Intergenic
981202670 4:141999458-141999480 CTGCCTAGGAGTAGAATTGCTGG + Intergenic
981521407 4:145666361-145666383 ATAGCTAGAAGTGGAATTGCTGG + Intergenic
982119711 4:152130767-152130789 CTGGCTAGATACAGAATTCTGGG + Intergenic
983091684 4:163510972-163510994 CTTCCTAGAACTATAATTGTTGG + Intronic
984747202 4:183233082-183233104 ATGCCTTGAAGTAGAATTGTTGG + Intronic
984960458 4:185092671-185092693 CTCGCTTGGAGTGGAATTGTTGG - Intergenic
985365019 4:189220762-189220784 ATATCTAGAATTAGAATTGTGGG - Intergenic
985698278 5:1355356-1355378 CTGCTTAGAAGTGGAATTGAAGG + Intergenic
987530049 5:19106163-19106185 ATACCTAGAAGTTGAATTGTCGG + Intergenic
987763852 5:22199671-22199693 CTCAGTAGATGTAGAATTGTGGG + Intronic
988611183 5:32727081-32727103 ATTTCTAGAAGTGGAATTGTTGG + Intronic
988767362 5:34394252-34394274 TTGTCTAGGAGTGGAATTGTGGG - Intergenic
988850736 5:35177819-35177841 ATAGCTAGTAGTGGAATTGTTGG + Intronic
988892381 5:35631589-35631611 ATATCTAGAAGTAGAATTGTTGG - Intronic
989009451 5:36853694-36853716 ATTTCTAGAAGTAGAATTGCTGG - Intergenic
989131225 5:38108668-38108690 ATGATTAGAAGTAGAATTGCTGG + Intergenic
990464995 5:56063399-56063421 TTGGATAGAAGTGGAATTGCTGG - Intergenic
990606249 5:57413326-57413348 ATATCTAGAAGTAGAATTGCTGG + Intergenic
990752401 5:59031210-59031232 ATACCTAGAAGTAGGATTGTTGG - Intronic
990805425 5:59655049-59655071 ATACCTAGAAGTAGAATTGCTGG + Intronic
991144048 5:63280202-63280224 ATAGCTAGAAGTACAATTGCTGG + Intergenic
991438946 5:66625769-66625791 CTAACCAGAAGTAGAATTGCTGG - Intronic
991898577 5:71432750-71432772 CTCAGTAGATGTAGAATTGTGGG + Intergenic
992131982 5:73702552-73702574 ATACCTAGAAGTAGAATTGCTGG + Intronic
992511640 5:77442169-77442191 ATTCCTAGAAGTGGAATTGTTGG - Intronic
992590058 5:78285529-78285551 CAGGCTAGAAGTATAAATTTGGG - Intronic
992628913 5:78661881-78661903 ATGCCTATAAGTAGAATTGTTGG - Intronic
992707324 5:79409990-79410012 ATACCTAGAAGTAGAATTGCTGG - Intronic
993284144 5:85968023-85968045 ATATCTAGAAGTAGAATTGCTGG + Intergenic
993608876 5:90030562-90030584 ATACCTAGGAGTAGAATTGTTGG - Intergenic
994952711 5:106484992-106485014 ATAGTTAGAAGTAGAATTATGGG + Intergenic
995383615 5:111564370-111564392 ATGGGTAGAAATTGAATTGTGGG + Intergenic
995700277 5:114928265-114928287 ATTCCTAGAAGTAGAATTGCTGG - Intergenic
996423413 5:123286766-123286788 CTTGCTGGAAGTGGAATTGCTGG + Intergenic
996676940 5:126186977-126186999 GCGGATAGAAGTAGAATTGTGGG - Intergenic
996705886 5:126497990-126498012 CAGGAGAGAAGTAGATTTGTTGG + Intergenic
997781687 5:136666101-136666123 TTAGGAAGAAGTAGAATTGTGGG + Intergenic
997833036 5:137168833-137168855 ATACCTAGAAGTAGAATTGCTGG - Intronic
999558911 5:152777435-152777457 ATGTCTAGGAGTAGAATTGTGGG + Intergenic
999846739 5:155489987-155490009 CTATTTAGAAGTAGAATGGTTGG + Intergenic
1000015817 5:157274583-157274605 ATGCCTAGGAGTAGAATTGCTGG + Intronic
1000430173 5:161142251-161142273 CTGGCTGGATGTAAAATTCTGGG - Intergenic
1003329127 6:5115211-5115233 GTTTCTAGAAGTAGAATTGTTGG + Intronic
1003436584 6:6094659-6094681 ATACCTAGAAGTAGAATTGCTGG + Intergenic
1004133391 6:12942996-12943018 CTGTCTAGGAGTGGAATTGCTGG - Intronic
1004370204 6:15045720-15045742 ATGACTAGAAGTAGAATTGCTGG - Intergenic
1005093709 6:22087183-22087205 ATATCTAGAAGTAAAATTGTAGG - Intergenic
1005859650 6:29890371-29890393 GTGGCTAGAGGAAGAATTGTGGG - Intergenic
1005875897 6:30009252-30009274 GTGGCTAGAGGAGGAATTGTGGG - Intergenic
1006439149 6:34042572-34042594 CGGGCTAGGAGTAGAATGATAGG - Intronic
1006821083 6:36895860-36895882 ATACCTAGAAGTAGAATTGCTGG + Intronic
1008032919 6:46717362-46717384 CTGGATAGAAGTAGAATGAGAGG - Intronic
1009765199 6:68064572-68064594 ATTTCTAGAAGTGGAATTGTTGG - Intergenic
1010211766 6:73367827-73367849 CTTTCTGGAAGTAGAATTTTTGG - Intergenic
1010617718 6:78032783-78032805 ATGCCTAGGAGTAGAATTGCTGG + Intergenic
1010988198 6:82450220-82450242 AGGGCTAGGAGTAGAATTGTAGG + Intergenic
1011704617 6:89988604-89988626 CTGACTACAAGTAGAAGAGTTGG + Intronic
1012621169 6:101345692-101345714 ATGCATAGAAGCAGAATTGTTGG - Intergenic
1013824837 6:114199048-114199070 CTGTCTAGAAGTAGAACTGAGGG + Intronic
1014182122 6:118396425-118396447 CTGGTTAGAAGTTGGACTGTTGG + Intergenic
1014204466 6:118642409-118642431 CTAGCCAGAAGTAAAATTCTAGG + Intronic
1014236025 6:118955871-118955893 ATACCTAGAAGTAGAATTGCTGG + Intergenic
1015263980 6:131270581-131270603 CTAGCTAGAAGTAGATTAATGGG + Intronic
1015723423 6:136271304-136271326 ATGTCTAGTAGTAGAAATGTGGG - Intronic
1015844275 6:137503158-137503180 CAAGCTAGGAGTAGAATTTTGGG - Intergenic
1015888632 6:137946581-137946603 CTGGCTAGAGGTAAAAATATGGG - Intergenic
1016237335 6:141884092-141884114 ATGGCTAAAAGTAAAATTATTGG + Intergenic
1017199605 6:151738374-151738396 ATGTCCAGAAGTGGAATTGTTGG + Intronic
1017300991 6:152857479-152857501 ATTCCTAGAAGTAGAATTGCTGG - Intergenic
1018157570 6:161001719-161001741 ATTGCTAGCAGTAGGATTGTGGG + Intronic
1019410084 7:902894-902916 GTGGCTAGATATAGAATTCTAGG - Intronic
1020498716 7:8889879-8889901 ATGCCTAGGAGTACAATTGTTGG + Intergenic
1021462242 7:20901454-20901476 CTTTCTAGGAGTAGAATTGCCGG - Intergenic
1021629075 7:22625839-22625861 ATTGGTAGAAGTAGAATTGCTGG + Intronic
1022268013 7:28777057-28777079 ATGCCTAGGAGTAGAATTGCTGG + Intronic
1022897643 7:34768252-34768274 TTTGCTAGATGTAGAATTCTGGG - Intronic
1023819719 7:43973840-43973862 ATGTCTAGAAGCAGAATTGCTGG + Intergenic
1024105717 7:46083271-46083293 TTTGCTAGAAATAGAATTTTTGG - Intergenic
1024978497 7:55135181-55135203 ATGGCTAGAAGGAGAATCATGGG + Intronic
1025195627 7:56930312-56930334 GTACCTAGAAGTAGAATTGCTGG + Intergenic
1025243269 7:57295808-57295830 CTGGGTAGAAGCAGGATTGCTGG + Intergenic
1025676323 7:63646627-63646649 GTACCTAGAAGTAGAATTGCTGG - Intergenic
1026455750 7:70571219-70571241 CTCGCTAGAAGTAGAACTTTGGG + Intronic
1028036757 7:85993490-85993512 ATGCCTAGAAGTGGAATTGCTGG + Intergenic
1028247712 7:88501788-88501810 TTGGCTGGATGTAGAATTCTAGG + Intergenic
1028739966 7:94262716-94262738 CTCACTAGATGTAGAATTTTTGG - Intergenic
1028861187 7:95652482-95652504 ATACTTAGAAGTAGAATTGTGGG + Intergenic
1029013327 7:97286290-97286312 ATACCTAGAAGTAGAATTGTTGG + Intergenic
1029747992 7:102527293-102527315 ATGTCTAGAAGCAGAATTGCTGG + Intergenic
1029765941 7:102626388-102626410 ATGTCTAGAAGCAGAATTGCTGG + Intronic
1029937443 7:104441903-104441925 CTGCCCAGAAGTGGAATTGCTGG + Intronic
1030156918 7:106464957-106464979 CTGCCCAGGGGTAGAATTGTGGG - Intergenic
1030167015 7:106565363-106565385 GTGGCTAGAGGAAAAATTGTTGG - Intergenic
1030351625 7:108495191-108495213 ATTTCTAGAAGTAAAATTGTGGG - Intronic
1030582559 7:111376531-111376553 ATAGCTAGGAGTAGAATTGATGG - Intronic
1032288111 7:130558816-130558838 CTGGCTTTAAATAGAATTTTGGG + Intronic
1032336723 7:131031682-131031704 CTGACTAAAAGTAGAATTGAAGG + Intergenic
1032920579 7:136541490-136541512 AAGCCTAGAAGTAGAATTTTTGG + Intergenic
1033225150 7:139555523-139555545 ATGCCTAGAAGTAGAATTGCTGG + Intergenic
1033415689 7:141159429-141159451 ATGCCCAGAAGTAGAATTGCTGG - Intronic
1034119393 7:148613291-148613313 ATACCTAGAAGTAGAATTGCTGG - Intronic
1034230614 7:149524432-149524454 ATGCCTAGTAGTAGAATTGCTGG - Intergenic
1035067630 7:156119823-156119845 CTGCCTAGAAATGGAATTGCAGG - Intergenic
1037400377 8:18489871-18489893 ATGCCTTGGAGTAGAATTGTTGG - Intergenic
1037402962 8:18511871-18511893 ATATCTAAAAGTAGAATTGTTGG - Intergenic
1038154603 8:24976951-24976973 ATACCTAGAAGTGGAATTGTTGG + Intergenic
1038248272 8:25879404-25879426 ATTTCTAGAAGTAGAATTGCTGG + Intronic
1038320568 8:26522361-26522383 CTGCCTAGAAGTAGAATTGCTGG + Intronic
1038344998 8:26724580-26724602 CTGTATAGAAGTGGAATTGTTGG + Intergenic
1039452411 8:37686045-37686067 ATTCCTAGGAGTAGAATTGTTGG - Intergenic
1039768387 8:40656423-40656445 ATGCCTAGGAGTAGAATTGCTGG - Intronic
1039924138 8:41914087-41914109 ATGCCCAGAAGTGGAATTGTTGG + Intergenic
1040989075 8:53329797-53329819 CTGGCTTAAAGAAGAAATGTGGG - Intergenic
1042251954 8:66765072-66765094 ATATCTAGAAGTAGAATTGCTGG + Intronic
1042783220 8:72515876-72515898 GTAGCTAGAAGTGGAATTGTAGG - Intergenic
1042830612 8:73023917-73023939 TTGTCTAGAAGTGGAATTGCTGG - Intronic
1043179611 8:77070717-77070739 ATAGCCAGAAGTAGAATTGCTGG + Intergenic
1043561145 8:81494803-81494825 CATGCTAGAGGTAGAATTGATGG + Intergenic
1044305345 8:90633560-90633582 ATCACTAGAAGTAGAATTATTGG + Intronic
1044855868 8:96475236-96475258 ATGCCTAGGAGTAGAATTGCTGG - Intergenic
1045074537 8:98549119-98549141 CTACCTAGAAGTACAATTGCTGG + Intronic
1045223678 8:100223281-100223303 ATGCCTAGGAGTAGAATTGCTGG + Intronic
1045339260 8:101237597-101237619 ATACCTAGAAGTGGAATTGTTGG + Intergenic
1046098500 8:109587797-109587819 CTGGCTCCCAGTAGAATTCTGGG + Intronic
1046301016 8:112289471-112289493 CTGGCGAGAAGTATACTTTTGGG - Exonic
1046574818 8:116014181-116014203 ATGTCTAGAAGTGGAATTGCTGG + Intergenic
1047890002 8:129297476-129297498 ATATCTAGAAGTAGAATTGCAGG + Intergenic
1048325988 8:133439529-133439551 ATGCCTAGGAGTAGAATTGCTGG + Intergenic
1048398580 8:134040187-134040209 ATATCTAGAAGTAGAAATGTTGG - Intergenic
1048682465 8:136858860-136858882 ATGGCTATGAGTAAAATTGTGGG + Intergenic
1049982946 9:921503-921525 ATGCCTAGAAGTGGAATTGCTGG + Intronic
1050383557 9:5058564-5058586 ATACCTAGAAGTAGAATTGCTGG + Intronic
1050438457 9:5634245-5634267 ATACCTAGAAGTAGGATTGTTGG + Intronic
1052923305 9:33990960-33990982 GGGCCTAGAAGTAGAATTGCTGG - Intronic
1052965463 9:34337340-34337362 GTGGCTAGAAATGGAATTGCTGG + Intronic
1053048570 9:34939734-34939756 CTGAGTAGAAGTAGATGTGTGGG - Intergenic
1053230859 9:36408018-36408040 ATTTCTAGAAGTAGAATTGCTGG + Intronic
1054729668 9:68688421-68688443 CTATCTAGAAGTAGAATTGCAGG - Intergenic
1055152664 9:73021387-73021409 CTGCCTAGAAGTAGCATTCCAGG + Intronic
1055153326 9:73030184-73030206 ATGCCCAGAAGTAAAATTGTTGG + Intronic
1055987493 9:82066357-82066379 CTATCTAGAAGTGGAATTGCTGG - Intergenic
1057094167 9:92290068-92290090 GTAGCTAGAAGTAGAATTTCTGG + Intronic
1057301758 9:93890212-93890234 ATACCTAGAAGTAGAATTGGTGG - Intergenic
1057771899 9:97975583-97975605 TTGCCTAGGAGTAGAATTGCTGG + Intergenic
1058163081 9:101591652-101591674 CTGTATAGAACTAGATTTGTTGG + Exonic
1058880503 9:109281878-109281900 TTACCTAGAAGTAGAATTGTTGG - Intronic
1058996658 9:110305466-110305488 ATAGCTAGAAGTGGGATTGTGGG + Intronic
1059109940 9:111547175-111547197 ATGCCTAGAAATAGAATTGCTGG + Intronic
1059187695 9:112290856-112290878 GTGTCTAGAAGTGGAATTATTGG - Intronic
1059213341 9:112535592-112535614 ATGCCCAGAAGTAGAATTGCTGG + Intronic
1059746504 9:117206700-117206722 CTGGCTGGAAGTAGGGTAGTGGG - Intronic
1059788153 9:117609714-117609736 GTATCTAGAAATAGAATTGTTGG - Intergenic
1059800243 9:117742840-117742862 ATGGGCAGAATTAGAATTGTGGG + Intergenic
1062256803 9:135627677-135627699 ATATCTAGAGGTAGAATTGTTGG + Intronic
1185588410 X:1257565-1257587 CTGTGTAGAAGCAGAATTGGTGG - Intergenic
1186680917 X:11873013-11873035 ATACCTAGAAGTAGAATTGCTGG - Intergenic
1186858306 X:13646834-13646856 TGGGCTAGAAGCAGAACTGTGGG + Intergenic
1186881982 X:13875504-13875526 GTAGCTAGAAGTGGAATTGTTGG - Intronic
1187398072 X:18935170-18935192 ATGGTTAGAAGAAGAATTCTTGG - Intronic
1187457202 X:19452471-19452493 ATGCCCAGAAGTAAAATTGTTGG - Intronic
1187642181 X:21305271-21305293 TTGGCTAGGTGTAGAATTCTAGG - Intergenic
1189000607 X:36940412-36940434 CTGGAAAGAAGTAGAGTGGTGGG - Intergenic
1189434322 X:40977913-40977935 CCATCTAGGAGTAGAATTGTTGG + Intergenic
1189980613 X:46506656-46506678 TTGGCTTGAAGTAGAGTTCTAGG - Intronic
1192556130 X:72091114-72091136 CTGGAAAGAAGTGGAATTGTTGG + Intergenic
1192597323 X:72425062-72425084 ATATCTAGAAGTAGATTTGTGGG + Intronic
1192866714 X:75141695-75141717 TTTCTTAGAAGTAGAATTGTTGG + Intronic
1193110364 X:77723307-77723329 ATATCTAGAAGTAGAATTGTTGG - Intronic
1193987349 X:88260317-88260339 ATGCCCAGTAGTAGAATTGTGGG + Intergenic
1194392520 X:93337953-93337975 CAGGATAGAAGTATAATTGCTGG + Intergenic
1195311626 X:103637670-103637692 GTGACTAGAAGTGGAATTGTTGG + Intergenic
1195805464 X:108760788-108760810 CTACCTAGAAGTGGAATTGCTGG + Intergenic
1195935482 X:110121697-110121719 GTACCTAGAAGTAGAATTGCTGG + Intronic
1196046646 X:111262870-111262892 TGGGCTTCAAGTAGAATTGTAGG - Intronic
1196064740 X:111451286-111451308 ATAGCTAGGAGTAGAATTGCTGG - Intergenic
1196723239 X:118874432-118874454 ATACCTAGAATTAGAATTGTTGG + Intergenic
1197193954 X:123679573-123679595 CAGGCCAGAAATAGAAGTGTGGG - Intronic
1197735648 X:129849058-129849080 CTAGATAGAAGTAGGATTGTTGG - Intergenic
1197965979 X:132062208-132062230 CTGACTGGAAGTAGAATGGTTGG - Intergenic
1198225331 X:134640088-134640110 ATACCTAGAAGTGGAATTGTGGG + Intronic
1198279019 X:135124097-135124119 CTGGCTAGAAGTAGAATTGTAGG - Intergenic
1198291939 X:135248423-135248445 CTGGCTAGAAGTAGAATTGTAGG + Intergenic
1198297972 X:135305402-135305424 CTGGCTAGAAGTAGAATTGTAGG + Intronic
1198547781 X:137711296-137711318 ATGCCTAGGAGTAGAATTGTTGG - Intergenic
1198623575 X:138542247-138542269 CTGTATAGAAGTGGAATCGTTGG + Intergenic
1199394517 X:147319225-147319247 ATATCTAGAAGTAGAATTGCTGG + Intergenic
1199532226 X:148862677-148862699 CTGGCAAGAACTAGAATTTCTGG + Intronic
1199849170 X:151713161-151713183 GTGCCTATAAGTGGAATTGTGGG - Intergenic
1200050389 X:153426521-153426543 ACGGCTAGGAGTGGAATTGTTGG + Intergenic
1200396864 X:155995917-155995939 ATTGCTAGGGGTAGAATTGTGGG - Intergenic
1200967191 Y:9108264-9108286 AGGGCTAGAATTAGAGTTGTGGG + Intergenic