ID: 1198299793

View in Genome Browser
Species Human (GRCh38)
Location X:135324073-135324095
Sequence CTTTCTGGGGAGAGGAGGGC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 783
Summary {0: 1, 1: 7, 2: 28, 3: 95, 4: 652}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1198299784_1198299793 19 Left 1198299784 X:135324031-135324053 CCAAAGAAGGTTTTTAAGAGGTT 0: 1
1: 0
2: 2
3: 19
4: 315
Right 1198299793 X:135324073-135324095 CTTTCTGGGGAGAGGAGGGCAGG 0: 1
1: 7
2: 28
3: 95
4: 652
1198299783_1198299793 20 Left 1198299783 X:135324030-135324052 CCCAAAGAAGGTTTTTAAGAGGT 0: 1
1: 0
2: 0
3: 18
4: 294
Right 1198299793 X:135324073-135324095 CTTTCTGGGGAGAGGAGGGCAGG 0: 1
1: 7
2: 28
3: 95
4: 652

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1198299793 Original CRISPR CTTTCTGGGGAGAGGAGGGC AGG Intronic
900105568 1:979439-979461 CTGTCTGGGGGGCTGAGGGCCGG + Exonic
900255478 1:1696082-1696104 CCTTCTGGGGAGAGGAAGAGAGG - Intronic
900264040 1:1748313-1748335 CCTTCTGGGGAGAGGAAGAGAGG - Intergenic
900324924 1:2104053-2104075 TTTTCTGGGGAGAGCAGGGGAGG + Intronic
900526832 1:3133477-3133499 CACGATGGGGAGAGGAGGGCAGG + Intronic
900959746 1:5911262-5911284 TTTTCTGGGAGGAGGTGGGCAGG - Intronic
901184985 1:7367214-7367236 CTCTCTGAGGAGAAGAGAGCTGG - Intronic
901654162 1:10759815-10759837 ATGTCTGGGGAGGGCAGGGCCGG - Intronic
901693943 1:10992492-10992514 CTTCGTGGGGAGGGGAGGGGAGG + Intergenic
901853799 1:12031599-12031621 CTTCCTGGGTGGAGCAGGGCAGG - Intronic
902609095 1:17586807-17586829 CTTTAATGGGAGAGGAGGACAGG + Intronic
903319148 1:22531615-22531637 CTGTCTTTGGAGAGCAGGGCTGG + Intergenic
903944101 1:26951089-26951111 CTTTCTGGGGACAGCAGCGATGG + Intronic
904494584 1:30879480-30879502 CTTTCTGGGCAGAGGGGAGCTGG - Intronic
904821732 1:33249552-33249574 CTTTCTTGGGGGAGTGGGGCAGG - Intergenic
905220239 1:36441127-36441149 CCTGCTGGGAAGAGGACGGCGGG + Intronic
905435029 1:37950123-37950145 CTTGTTGGGGAGGGGAGTGCTGG + Intergenic
905807074 1:40884674-40884696 CTTTGTGGGGAAATGAGGGAAGG + Intergenic
905898807 1:41567135-41567157 CTTTATGGGGTGAGAAGGGATGG - Intronic
906032349 1:42731820-42731842 CCTTCTGGGGTGGGGGGGGCGGG + Intergenic
906545738 1:46618024-46618046 CCTGCTTGGGAGTGGAGGGCGGG + Intergenic
906677432 1:47703183-47703205 ATTTATGGGGACAGGAGGGAGGG - Intergenic
907020283 1:51060182-51060204 CTCTCTGGGGAGAGGAGACCTGG - Intergenic
907099910 1:51821552-51821574 GTTTCTTGAGAGGGGAGGGCAGG + Exonic
907406797 1:54258683-54258705 TTTCCTGGGGGCAGGAGGGCCGG + Intronic
908416047 1:63914385-63914407 CTTCCTAGGGAGAGGAAGGCAGG + Intronic
909931293 1:81502840-81502862 TTGGGTGGGGAGAGGAGGGCAGG - Intronic
910981768 1:92965286-92965308 CTTTCTGGGGAGAGCAGGGCAGG - Intergenic
911090256 1:94011966-94011988 TTGTCTAGGGAGAGGAGGGTTGG + Intronic
911205774 1:95090357-95090379 AATTCTGGGCAGAAGAGGGCAGG - Intergenic
911294408 1:96097114-96097136 GTATCTGGGGAGAGTCGGGCGGG - Intergenic
911506678 1:98761579-98761601 CTTTCTGGGGAGAGCAAGGCTGG - Intergenic
911525003 1:98973886-98973908 ATTTCTGGGCAGGGGAGGGGTGG + Intronic
912588142 1:110785809-110785831 CTTTCTGGGGAGAGCAGAGCAGG - Intergenic
912805657 1:112755053-112755075 CTTTCTAGGGAGAGCAGAGCAGG + Intergenic
913098502 1:115541548-115541570 CTTTCCGGGGTGATGAGGTCAGG - Intergenic
915528623 1:156490755-156490777 CTTGCCAGGGAGAAGAGGGCGGG - Intronic
915529356 1:156494475-156494497 CTGGATGGGGAGGGGAGGGCTGG + Intronic
915725584 1:158014675-158014697 CTTTATGGGGGGGGGGGGGCGGG + Intronic
915903290 1:159861512-159861534 CTGTCTGATGAGAGCAGGGCTGG - Intronic
915940511 1:160115687-160115709 CTTTCGGAGGAGGGGAAGGCGGG + Intergenic
915955174 1:160214856-160214878 CTTTAATGGGAGGGGAGGGCTGG + Exonic
916171086 1:162002234-162002256 AGTCCTGGGGAGAGCAGGGCTGG - Intronic
916560432 1:165930150-165930172 CTTACTGTGGGGAGGAGGGAAGG + Intergenic
916734541 1:167596320-167596342 CTTTGTGGAGAGAGCAGGGAGGG + Intergenic
916753496 1:167745021-167745043 CTTTTTGGGGAGAGCAGGGCAGG + Intronic
917106209 1:171494774-171494796 CTTTCTTGAGGGAGGGGGGCAGG - Intronic
917700052 1:177571369-177571391 CTTTCTGGAGTGAGGAGGTATGG + Intergenic
917787208 1:178471675-178471697 CTTTCTGGGGGCAGGAGGGTAGG - Intronic
917803383 1:178591398-178591420 CTGGCTAGGGAGAGGAGGCCAGG + Intergenic
917973186 1:180221643-180221665 CTTTCTGGGCAGCGGAGTACTGG + Intergenic
918175522 1:182040970-182040992 CATTGTGGGGTGAGTAGGGCAGG + Intergenic
918338316 1:183544471-183544493 CCTGCTGGGAAGAGGAGGGAAGG - Exonic
918614932 1:186533074-186533096 CTTTCTGAGTAGAGGAGTGGTGG - Intergenic
919082156 1:192879456-192879478 TTTGCTGGGGAGAGGTGGGATGG - Intergenic
919408881 1:197218962-197218984 CTTGATGGGGAGAGGAGGACAGG + Intergenic
919606826 1:199693647-199693669 CTTTCTGGGAAGTGGGGGACAGG - Intergenic
919741506 1:200983901-200983923 ATTTCTGTGGAGAGGTGGGGAGG + Intronic
919799824 1:201346947-201346969 CTTTCTGGGGGGGGCAGGGCTGG - Intergenic
920155273 1:203944643-203944665 CTTCCTGGGGAGAGGAGTAAGGG + Intergenic
920247891 1:204602154-204602176 GATTCAGGGGAGAGGAGGGGAGG - Intergenic
920496573 1:206459122-206459144 CTTCCTGGGGAGAGAGGGACAGG - Intronic
921479957 1:215652710-215652732 CTTTCTGGGAAGTGGTGGGGGGG + Intronic
921580008 1:216885392-216885414 ATGTCTGGGGAGAGGAGGCATGG + Intronic
921674964 1:217966607-217966629 AATTCTGGGCAGAGGAGGGTGGG - Intergenic
922005469 1:221526303-221526325 CTTTCTAAGGCAAGGAGGGCTGG - Intergenic
922160288 1:223074633-223074655 CTTTGTGGGGAGAGGAGGCAGGG + Intergenic
922473641 1:225891152-225891174 CTGTCTGGGCTGAGGAGGGTGGG + Intronic
923328139 1:232898603-232898625 GTTTCTGGGCAGAAAAGGGCAGG + Intergenic
923403899 1:233642018-233642040 CTTTTGGTGGAGAGGTGGGCAGG + Intronic
923507850 1:234621720-234621742 CTTTCTGGAGAGTGGAAGACTGG + Intergenic
924772973 1:247092173-247092195 GTCTTTGGGGAGAGCAGGGCAGG - Intergenic
1062886088 10:1017186-1017208 CTGTCTGGGAAGAGGAAAGCTGG + Exonic
1063104698 10:2982874-2982896 CTTTCTATGGATAGGAGGGGAGG - Intergenic
1063212143 10:3890464-3890486 TTTTTTGGGGGGAGGGGGGCAGG + Intergenic
1063247645 10:4238774-4238796 CTTCCTGGGGAATGGAGGGAGGG - Intergenic
1063677126 10:8150740-8150762 CTTCCTGGGGGGCGGAGGGTGGG + Intergenic
1063690394 10:8281747-8281769 TTTTGTGGGGAGAGGTGGGTAGG + Intergenic
1064163392 10:12965182-12965204 CTTTTTGGGGAAAGCAGGGAGGG - Intronic
1066357371 10:34698055-34698077 CTTGGTGGGAAGAGGTGGGCAGG - Intronic
1066393029 10:34994107-34994129 CTTTCTCTGGAGAGCTGGGCTGG - Intergenic
1066565589 10:36718597-36718619 CTTTTTGTGGAGATGAGGTCTGG - Intergenic
1066965005 10:42255265-42255287 CTTGTTGGGGGGTGGAGGGCTGG - Intergenic
1067090009 10:43261711-43261733 CTGGCTGAGGAGAGGAGGGTTGG - Intronic
1067359641 10:45566765-45566787 CTTTCTGGCGGGGGGAGGGGGGG + Intronic
1068300746 10:55135515-55135537 GTTTCTGGGGAGACCAGGGAAGG - Intronic
1068321764 10:55427107-55427129 GATTCTGGGAAGATGAGGGCAGG - Intronic
1069723022 10:70561626-70561648 GTTTCTGGGGATTTGAGGGCGGG - Intronic
1069841295 10:71341039-71341061 CAGTCTGGGGAGAGGAGAGGCGG + Intronic
1070240363 10:74674157-74674179 ATTTCTGGGCAGAAGAGGGTAGG - Intronic
1070446956 10:76514490-76514512 CTTTCTGGAGAGAGCAGGGCAGG + Intronic
1071288036 10:84166854-84166876 CTTGCTGGGGCCAGGTGGGCAGG + Intergenic
1071410978 10:85394979-85395001 CTTTCTAGGGAGAGAAGGGCAGG - Intergenic
1072073514 10:91944725-91944747 GTTGCTGGGAAGAGGAGGGAAGG - Intronic
1072314542 10:94189406-94189428 TCTTGTGGGGAGAGGAGGGAAGG - Intronic
1072528727 10:96298173-96298195 CTGTCGGGGGCCAGGAGGGCTGG - Intergenic
1072734875 10:97872449-97872471 CTATCCTGGGAGAGGAGGGGAGG + Intronic
1073327990 10:102653514-102653536 ATATCTGGTGAGAGGAGGGCAGG + Intronic
1073454778 10:103629869-103629891 CCCCCTGGGGAGAGGAGGGGAGG + Intronic
1074711741 10:116183622-116183644 CTTTCTGGAGAGGAGAGGGCTGG - Intronic
1074780795 10:116800512-116800534 CTTTGTGGGGAGAGGGAGCCAGG + Intergenic
1076169856 10:128309944-128309966 CCACCTGGGGACAGGAGGGCAGG + Intergenic
1076443182 10:130494234-130494256 CTTTCTGGGGTGTAGAGGGGTGG + Intergenic
1076481456 10:130787829-130787851 CCTTCAGGGGGGAGGTGGGCAGG - Intergenic
1076783688 10:132738586-132738608 CTTTCTGGGAAGAAGGCGGCGGG - Intronic
1077056906 11:598205-598227 CTGGCAGGGGAGAGGAAGGCCGG + Intronic
1077105074 11:838628-838650 CTGTCGAGGGAGACGAGGGCTGG - Exonic
1077251720 11:1563699-1563721 CGTCCTGGGGAGAGGATGGTGGG + Intronic
1078497290 11:11831079-11831101 TTTTCTGAGGAGAGGAGGAAGGG + Intergenic
1079074374 11:17374647-17374669 GGTTCTGGGGAGAGGAAGGGAGG - Exonic
1079608990 11:22406794-22406816 CTTTCTGGGGAGAGCAGGGCAGG - Intergenic
1080017889 11:27526524-27526546 TTTTCTGGGGAGGGGAGGAGAGG + Intergenic
1080034219 11:27695432-27695454 ATTTTTGGAGAGAGGAGGTCAGG - Intronic
1080197415 11:29628749-29628771 CTTCCTGAGGAGAGGAGAGAGGG + Intergenic
1080373726 11:31683071-31683093 CTTTGTGGGGAGGAGAGGGAAGG - Intronic
1080667246 11:34346453-34346475 CTTTCTGGGGAAAGGGGCACAGG + Intronic
1081109868 11:39121469-39121491 CTCTCAGTGGAGAGGAGAGCTGG + Intergenic
1081798506 11:45840060-45840082 TTTTCTAGGGCTAGGAGGGCTGG - Intergenic
1082663826 11:55949350-55949372 CTCTCAGGGGAGAGGGGAGCTGG - Intergenic
1082767127 11:57179228-57179250 CTTTCTGGGGCTAGGAGGCTTGG - Intergenic
1082789745 11:57338986-57339008 CTTGTTGGGGAGATGAGAGCAGG - Intronic
1082824503 11:57567852-57567874 CTTTGTGCGGAGACGGGGGCGGG + Intronic
1083956079 11:65983590-65983612 CTTTCTGGGTAGAGGTGGGAAGG - Intergenic
1083964638 11:66035871-66035893 CTTGCTGGGGAGAAGAGGATTGG + Intergenic
1084167467 11:67382553-67382575 ATTACTGGGGAGATGGGGGCAGG - Intronic
1084227729 11:67727787-67727809 CTTTCTGGGCTGAGGTGGCCTGG + Intergenic
1084510966 11:69603491-69603513 TTTTCTGAAGACAGGAGGGCAGG + Intergenic
1084547848 11:69823259-69823281 CTCTCTGGGTAGAGGAGAGGAGG + Intergenic
1085100552 11:73796588-73796610 CTTCCTGGGCAGAAGGGGGCAGG + Intronic
1085322635 11:75583998-75584020 CTTTCTGGGTAGTGGAGGGCTGG + Intergenic
1085345660 11:75766817-75766839 CTCTCTGAGGAGAGGATGCCAGG + Intronic
1086933396 11:92718280-92718302 CTTTCTGGGGAGAACAGGGTGGG + Intronic
1088568406 11:111197305-111197327 CTTTCTGGGCAGAGCAGGTCCGG + Intergenic
1089298254 11:117482249-117482271 CTCTCCTGGGGGAGGAGGGCTGG - Intronic
1090178685 11:124674147-124674169 CAATGTGGGCAGAGGAGGGCGGG - Exonic
1090843536 11:130513062-130513084 CTGTGAGGGGAGAAGAGGGCAGG + Intergenic
1090990808 11:131815436-131815458 CTTGCTGTGGGGAGGAGGGATGG - Intronic
1091049263 11:132352738-132352760 CTGTCTGGGAGGAGCAGGGCAGG - Intergenic
1091801286 12:3326311-3326333 CCAACTGGGAAGAGGAGGGCAGG - Intergenic
1092144286 12:6203831-6203853 CTTTCTGGTCAGAGAAGGGGAGG + Intronic
1092154446 12:6273490-6273512 CTTATTGTGGAGAGGTGGGCAGG + Intergenic
1092445375 12:8551147-8551169 TTTTCTAGGAATAGGAGGGCAGG + Intergenic
1093401772 12:18754483-18754505 AATTCTGGGCAGAAGAGGGCAGG - Intergenic
1093464594 12:19437018-19437040 CTTTGTGGGGAAAGGAGTTCTGG - Intronic
1093632800 12:21430330-21430352 CTTTCTGGGGAGAATAGGACAGG - Intergenic
1094709946 12:32952001-32952023 CTTTCTGCTGAGGGGAGGGAAGG - Intergenic
1094740537 12:33283307-33283329 CTTTCTGGGAAGACAAGGGCTGG + Intergenic
1094757865 12:33492874-33492896 CTTTGTGGGGAGAGGGGTGTCGG + Intergenic
1095973989 12:47926847-47926869 CCCTCTGTGGAGAGGAGAGCTGG - Intronic
1096569278 12:52511610-52511632 CTTTCTGAGGAAAGCAAGGCAGG - Intergenic
1096718830 12:53506537-53506559 CTTTCTGGTGGGAGGAGGCTGGG + Intergenic
1097173691 12:57130696-57130718 GTTTCTGTGGAGAGCAGGGAAGG + Intronic
1097179814 12:57165335-57165357 CGTTCTGGGGACAGGATGGGTGG + Intronic
1097463589 12:59894379-59894401 ATTGCTGGGGACAGGTGGGCAGG - Intergenic
1097679221 12:62633191-62633213 TTTTCTGGGGAGGAGAGGGGAGG - Intergenic
1097883299 12:64705387-64705409 TTTTCTGGGGGGAGGGCGGCGGG - Intergenic
1098161000 12:67648545-67648567 TTTTCCGGGGAGCGGAGGGGCGG + Intronic
1098511526 12:71320198-71320220 GTTTCTGAGGAGAGGTGGTCTGG - Intronic
1100574000 12:95872110-95872132 CTATATGAGGAGAGCAGGGCTGG + Intronic
1100819169 12:98415117-98415139 TTTTCTGGGGAGAGCATGGCAGG + Intergenic
1101217399 12:102597600-102597622 AATTCTGGGAAGAAGAGGGCAGG - Intergenic
1101330415 12:103753332-103753354 CCTTCTGGGCATAGGAGAGCTGG - Exonic
1101423198 12:104565946-104565968 GTTTCTTGGGAGAGCAGGGATGG + Intronic
1101672109 12:106885029-106885051 CTTTCTAGGGATGGGAGGACTGG + Intronic
1101930085 12:109006681-109006703 GGTTCTGGGGTGATGAGGGCAGG + Intronic
1101979834 12:109396448-109396470 ATTTCTGGAGAGAGTGGGGCAGG + Exonic
1102101441 12:110281529-110281551 CCTTCTGGCGAGGGGAGGGAGGG + Intronic
1102262023 12:111448674-111448696 CTTTCTACGGGGAGGAGGGGGGG + Exonic
1103500679 12:121399752-121399774 GTTTCCGGGGAGGGGAGCGCGGG - Intronic
1103896136 12:124274479-124274501 CTTCTGGGGGAGGGGAGGGCGGG + Intronic
1103983344 12:124750922-124750944 CTTTCTGGGGTGAAGGGGGCGGG + Intergenic
1103998171 12:124843277-124843299 CTTTCTGTGGAGATGGGGGGGGG + Intronic
1104285152 12:127418262-127418284 CTCTCAGTGGAGAGGAGAGCTGG - Intergenic
1104287600 12:127439284-127439306 TGTTGTGGGGAGAAGAGGGCTGG - Intergenic
1104338010 12:127918783-127918805 AATTCTGGGGAGGGGAGGGCAGG - Intergenic
1104798231 12:131534653-131534675 GTTTCTGGGAAGAGCAGAGCTGG + Intergenic
1104834204 12:131776847-131776869 CTTTCTGGGTAAAGAGGGGCAGG + Intronic
1104933281 12:132351667-132351689 CCCTCTGGGGACAGGAGGGATGG + Intergenic
1106099165 13:26679536-26679558 CTTTCTGATGAGATGAGGGTAGG - Intronic
1106104032 13:26718336-26718358 CTTTCTGGAGACAGCAGGGCAGG + Intergenic
1106504952 13:30363067-30363089 TTTGCCAGGGAGAGGAGGGCGGG - Intergenic
1107406360 13:40117736-40117758 CTGCCTGGGGAGAGGGAGGCAGG + Intergenic
1107564632 13:41589577-41589599 CTTTGTGGGGAGAGGGAGGAAGG - Intronic
1107668302 13:42715986-42716008 CTTTCTGGGGACAGCAGGGCAGG + Intergenic
1107803155 13:44129577-44129599 CTTTCTGGAGAGAGGCTGCCAGG - Intergenic
1107854092 13:44597644-44597666 AATTCTGGGAAGAAGAGGGCAGG - Intergenic
1108340868 13:49496800-49496822 CTTTTTGAGGAGAGGATGGCTGG + Intronic
1108487635 13:50942970-50942992 AATTCTGGGCAGAAGAGGGCCGG - Intronic
1108493200 13:51001206-51001228 CTCTCCGGGGAGAGGGGGCCAGG + Intergenic
1108731544 13:53240499-53240521 CTTTCTGGGGGCAGGAGCGGGGG + Intergenic
1108767589 13:53651311-53651333 CTTTCTGGGAAGAGTAGGACAGG - Intergenic
1109004355 13:56852439-56852461 CTTTCTGGGGAGGGCAGAGCAGG + Intergenic
1109633734 13:65085941-65085963 CTTCCTGGGGAGAAAGGGGCAGG - Intergenic
1109931729 13:69225184-69225206 CTTTCTGGAGAGAGTAAGGGAGG + Intergenic
1110807274 13:79770883-79770905 CTTTCTGAGGATAGCAGGGCAGG + Intergenic
1111025664 13:82518579-82518601 CTTTCTGGGGAGAGCTGGAGAGG - Intergenic
1111806161 13:93042465-93042487 CTTTCTGGAGAGACTAAGGCAGG + Intergenic
1111936689 13:94565207-94565229 CTGCCTGGGGTGAGGAGGGAGGG + Intergenic
1113010642 13:105761857-105761879 CCTTCTGGGCTGAGGAGAGCTGG + Intergenic
1113353460 13:109553289-109553311 GTTTGTGGGGAGATGAAGGCTGG - Intergenic
1113942786 13:114027119-114027141 CTCTCTTGGGAGAGGAGGGAAGG + Intronic
1113959754 13:114119935-114119957 CTGGCTGGAGAGAGGAGGGAGGG - Intronic
1113959775 13:114120005-114120027 CTGGCTGGAGAGAGGAGGGGGGG - Intronic
1113959833 13:114120179-114120201 CTGGCTGGAGAGAGGAGGGAGGG - Intronic
1113959853 13:114120249-114120271 CTGGCTGGAGAGAGGAGGGGGGG - Intronic
1113959875 13:114120319-114120341 CTGGCTGGAGAGAGGAGGGAGGG - Intronic
1113959912 13:114120429-114120451 CTGGCTGGAGAGAGGAGGGAGGG - Intronic
1113959932 13:114120499-114120521 CTGGCTGGAGAGAGGAGGGGGGG - Intronic
1113959954 13:114120569-114120591 CTGGCTGGAGAGAGGAGGGAGGG - Intronic
1114495818 14:23131456-23131478 CTTACTGTGAAGAGCAGGGCTGG + Exonic
1114665391 14:24374474-24374496 CCTGCTGGGGAGGGGAGGGCAGG + Intronic
1115069818 14:29307507-29307529 ATTTCTGAGGAGAGGTGGGAAGG + Intergenic
1116464790 14:45219076-45219098 CTTTATGGGGAGAGTGGGGGTGG - Intronic
1116563794 14:46418888-46418910 CTTTCTGGGAAGAGCAGGGAAGG - Intergenic
1117273288 14:54166864-54166886 CTTCCTGGGGAGAAGAGGCAAGG + Intergenic
1117289589 14:54319731-54319753 TTTTATGGGGAGTGGAGGGGAGG - Intergenic
1117460405 14:55939447-55939469 CTGTGTCGGGGGAGGAGGGCAGG + Intergenic
1117892103 14:60435707-60435729 CCTTCTGGGGAGAGCGGGGCAGG + Intronic
1117903828 14:60564222-60564244 CTTTCTCAGATGAGGAGGGCAGG + Intergenic
1119197400 14:72727204-72727226 CTTTCTGGGCAGAGGAGCAGTGG - Intronic
1119575341 14:75716011-75716033 CTTTGAGGGGAGAGGATGACAGG + Intronic
1119713245 14:76838346-76838368 CTTGGTGTGGAGAGGAGGGGAGG - Intronic
1119966585 14:78923059-78923081 CTTTCTAGGGACAGGCGGTCAGG + Intronic
1120255186 14:82109916-82109938 CTTTCGGGGGAGAGCAGGGCAGG + Intergenic
1120917086 14:89719730-89719752 GTATCTGTGGAGAGGAGGGATGG + Intergenic
1121332097 14:93056041-93056063 CGGTCTGGGGAAAGGAGGGAGGG + Intronic
1121492249 14:94369000-94369022 CTTTGCGGGGAGGAGAGGGCTGG + Intergenic
1121493433 14:94376218-94376240 CTTTCTGGAGAGCCCAGGGCAGG - Intergenic
1121780342 14:96618058-96618080 CTACCTGGGAAGAGGAGAGCAGG + Intergenic
1122643278 14:103175050-103175072 AATTCTGGGCAGAAGAGGGCAGG + Intergenic
1122961227 14:105094365-105094387 CTTTCGGGAGCGAGGAGGCCAGG - Intergenic
1122981185 14:105193009-105193031 CTTCCTGGGAAGAGGAGGGAGGG + Intergenic
1123018638 14:105387300-105387322 CATTCTCGGCAGAGGAGGGCGGG - Intronic
1123975365 15:25548696-25548718 CTGTGGTGGGAGAGGAGGGCTGG - Intergenic
1124254635 15:28130861-28130883 CATTCTGGGGAGAGGCTTGCAGG - Intronic
1125786410 15:42322390-42322412 CTTTCTGGGGAGAGCAGGGGTGG + Intronic
1127964184 15:63911760-63911782 CCTTCAGGGAAGAGGAGGACTGG + Intronic
1128708073 15:69851768-69851790 CTTTCTGGGAGGAGGAAGGGAGG + Intergenic
1129158396 15:73732898-73732920 CTTTCTTGGGGGTGGAGGACAGG + Intergenic
1131065034 15:89429279-89429301 CCTCCTGGGGAGAGGAGTGGAGG - Intergenic
1131368901 15:91863348-91863370 CTTTCAGGGTGGTGGAGGGCAGG + Intronic
1131430335 15:92383037-92383059 CTTTCTTGGGGGAGGAGGAGGGG - Intergenic
1131431851 15:92394327-92394349 CGGTTTGGGGAGAGGAGGGTGGG + Intronic
1131714812 15:95096853-95096875 CCGTCCGCGGAGAGGAGGGCTGG - Intergenic
1132153072 15:99475944-99475966 CTATCTGGGGTGGGGAGGGAGGG - Intergenic
1132205010 15:99980486-99980508 CTTTCTGGAGAGAGGAGCATGGG + Intronic
1132293984 15:100721573-100721595 GCTGCTGGGGAAAGGAGGGCGGG + Intergenic
1132647713 16:1006802-1006824 GTTTCTGTGGACAGGAGGGACGG - Intergenic
1132684290 16:1155836-1155858 CTCCAGGGGGAGAGGAGGGCTGG + Intronic
1132702564 16:1228394-1228416 CTGCCTGGGCAGGGGAGGGCCGG + Exonic
1132705760 16:1242474-1242496 CTATCTGGGCAGGGGAGGGCTGG - Exonic
1132709194 16:1258925-1258947 CTGCCTGGGCAGGGGAGGGCCGG - Exonic
1133071103 16:3247243-3247265 GTTTCTGGGGAGCAGAGGACAGG + Exonic
1133294805 16:4746490-4746512 CTTTCTGGGGACAGGTGGTCTGG - Exonic
1135057105 16:19240688-19240710 GCTTCTGGGCAGAAGAGGGCTGG - Intronic
1135078425 16:19413569-19413591 GTTTCTGGGGACAGTAAGGCTGG + Intronic
1135137378 16:19895116-19895138 AATGGTGGGGAGAGGAGGGCAGG + Intergenic
1136277324 16:29186704-29186726 CTTTCTGGGAAGGCGAGGGTCGG + Intergenic
1136548022 16:30966169-30966191 CAGTCTCGGGAGAGGAGGCCCGG + Exonic
1136716862 16:32288669-32288691 CTTGGTGGGGAGGGCAGGGCCGG - Intergenic
1136835238 16:33494914-33494936 CTTGGTGGGGAGGGCAGGGCCGG - Intergenic
1137283333 16:46996416-46996438 GTTTCTGGAGAGAGCAGGGCAGG + Intergenic
1137344354 16:47641119-47641141 TTTTGTGGGGAGGGGAGGGGAGG + Intronic
1137591143 16:49694704-49694726 CTTCCTGGATGGAGGAGGGCAGG - Intronic
1137616244 16:49848956-49848978 CTTTCTGGGGAAGGCAGGGAGGG + Intronic
1137785217 16:51133088-51133110 CTTTTTAGGGAGTGGAGGGAGGG - Intergenic
1138291278 16:55849282-55849304 ATTTCTGGGAAGGGGAGGGAGGG + Intronic
1138786247 16:59850094-59850116 CTTTCCGGGGAGAAAAAGGCAGG - Intergenic
1139301385 16:65948162-65948184 ATTTGTTGGGGGAGGAGGGCTGG - Intergenic
1139359377 16:66388068-66388090 CTTCCTGGGGAAATGAGGGAGGG - Intronic
1140067297 16:71622353-71622375 CTTTCTGGGGAGAGCAGAGCAGG - Intergenic
1140805773 16:78530703-78530725 AATTCTGGGCAGAAGAGGGCAGG - Intronic
1141153321 16:81579612-81579634 CCTTCAGGGGGGAGCAGGGCTGG - Intronic
1141438993 16:84017129-84017151 CTTCCTGGGGAGGTGAGGCCTGG - Exonic
1141605636 16:85151907-85151929 CCAGCCGGGGAGAGGAGGGCGGG - Intergenic
1141621361 16:85238242-85238264 CTGTCTGGGGATGTGAGGGCAGG - Intergenic
1141984812 16:87572827-87572849 CTTCCTGGGGAGGGGAGTGTGGG - Intergenic
1142081702 16:88152748-88152770 CTTTCTGGGAAGGCGAGGGTCGG + Intergenic
1203009565 16_KI270728v1_random:229118-229140 CTTGGTGGGGAGGGCAGGGCCGG + Intergenic
1203145410 16_KI270728v1_random:1795235-1795257 CTTGGTGGGGAGGGCAGGGCCGG - Intergenic
1142669829 17:1482973-1482995 ATCTCTGGGGAGAGCGGGGCAGG - Exonic
1142696862 17:1638714-1638736 CCTTGTGGGGTGGGGAGGGCTGG - Intronic
1142747741 17:1968385-1968407 CTGTCAGGAGAGAGGACGGCCGG - Intronic
1142787882 17:2238510-2238532 CTTTCTGGTCAGAGGTGGGGAGG + Intronic
1142854883 17:2724045-2724067 CTTGGTGGGGTGGGGAGGGCTGG - Intergenic
1142865982 17:2791803-2791825 CTTGATGGGGCCAGGAGGGCTGG + Intronic
1142958960 17:3540414-3540436 CTTGCTGGGGCGAGGAGGTCTGG - Intronic
1143449576 17:7027755-7027777 CTCACTGGGGAGAGCAGGGGTGG + Exonic
1143465615 17:7134310-7134332 AGTGCTGGGGAGAGAAGGGCGGG - Intergenic
1143514816 17:7414321-7414343 CTGTGTGGGGAGGGGTGGGCAGG - Intronic
1144417781 17:15068290-15068312 CTTTTTGGGGGGAGGGGGGCAGG + Intergenic
1144642252 17:16944009-16944031 CTTGGTGGGGAGAGGAGGGCAGG - Intronic
1145924039 17:28632844-28632866 CCCTCTGGGGAGGGGAGGGGAGG - Intronic
1146790146 17:35746323-35746345 CTTTTTGGGTAGATGAGGACTGG + Exonic
1146960065 17:36966758-36966780 CTTTCTTGGCAGGGGAGGGGAGG + Intronic
1147141785 17:38464567-38464589 CTTCCTGGGGAGAGGGAGGAAGG + Intronic
1147230122 17:39011651-39011673 AATTCTGGGCAGAAGAGGGCAGG + Intergenic
1147230560 17:39014966-39014988 CATTCAGGTGAAAGGAGGGCAGG - Intergenic
1147325509 17:39667794-39667816 CTTTCTGGGGCGGGGTGGGGAGG + Intergenic
1147522984 17:41192280-41192302 CTTCGTGGTGAGAGTAGGGCCGG - Intronic
1147977958 17:44258763-44258785 CTTAGTGGGGAGAGTAGGGGTGG - Intronic
1148109852 17:45138173-45138195 CCCTTTGGGGAGAGGAGGGAGGG - Intronic
1148470698 17:47891409-47891431 CTGTCGGGGGGGTGGAGGGCTGG - Intergenic
1148481219 17:47960556-47960578 ATTTCTGGGAGGAGCAGGGCTGG + Intergenic
1148866047 17:50629244-50629266 CCTACTGGGAAGAGGAGGCCAGG - Intergenic
1148895268 17:50835827-50835849 CCTGCTGGGGTGGGGAGGGCAGG + Exonic
1149656208 17:58310808-58310830 CTGTCTGGGGAGAGGGGAGCAGG - Intronic
1150667571 17:67156670-67156692 TTGTTAGGGGAGAGGAGGGCTGG - Intronic
1151767090 17:76138222-76138244 CTGGCAGGGGAGAGGAGGGGGGG + Intronic
1151846039 17:76656230-76656252 CTTTCTGGGGACTGGTGGCCAGG - Intergenic
1152013171 17:77733252-77733274 CTTTCTGGGGAAAAGATGGTGGG - Intergenic
1152551304 17:81031797-81031819 GCCGCTGGGGAGAGGAGGGCTGG - Intergenic
1152802813 17:82339789-82339811 CCTCATGGGGAGAGGAGGGAGGG + Intergenic
1153024254 18:658622-658644 CTTTCAGGGGACAGTGGGGCGGG + Intronic
1153126291 18:1796007-1796029 CTTTCTGGGGAGAGTAGCCCAGG + Intergenic
1154124120 18:11674358-11674380 CAGTCTGGGGAGAGGAGGCAGGG + Intergenic
1155441769 18:25869860-25869882 CTTGCTGGAGAGAGGCGGGGTGG - Intergenic
1155767264 18:29651331-29651353 CTTTCTCTGGAGAGGAGGATGGG + Intergenic
1156461928 18:37326099-37326121 CTGTCCTGGGAGAGGAGGCCGGG + Intronic
1156786088 18:40917020-40917042 CTTCCTGGGGAAAGGAGAGAAGG - Intergenic
1158172636 18:54616755-54616777 CTTTCTGGGGAGAGCACTGCAGG - Intergenic
1158532651 18:58277367-58277389 CTTCCTGGGGGCAGGAGGGAGGG + Intronic
1158592578 18:58790107-58790129 CCTTCTTGGGAGGGGAGAGCTGG + Intergenic
1158734169 18:60060995-60061017 CTTTCTAGGTGGAGGGGGGCGGG + Intergenic
1158832400 18:61294448-61294470 CTTTCTGGGGAGGACAGGGGAGG - Intergenic
1158934100 18:62348816-62348838 CATTCTGGGGAGGGGAAGGTGGG + Intronic
1158954807 18:62527012-62527034 CTTTCGGGGGGGGGGGGGGCGGG - Intronic
1160292799 18:77609421-77609443 ATTTCTGGGCAGAAGGGGGCGGG + Intergenic
1160334534 18:78027009-78027031 CATGCTGGGGAGAGCATGGCTGG + Intergenic
1160349732 18:78166629-78166651 CTGTCAGGGGAGAAGAGAGCAGG - Intergenic
1160835273 19:1122028-1122050 GAGTCAGGGGAGAGGAGGGCAGG - Intronic
1161079811 19:2305182-2305204 CCTTCTGGGGCGTGGAAGGCAGG + Intronic
1161118354 19:2511882-2511904 CTTCCTGGAGAGAGGAGGGCAGG + Exonic
1161203293 19:3028050-3028072 CTCTCTGGGGAGAGTAGAGGGGG - Intronic
1161338891 19:3730010-3730032 CTGTCCTGAGAGAGGAGGGCGGG - Exonic
1161419966 19:4171334-4171356 CTTGCAGGGGAGGGGAGGGAGGG + Intronic
1161660335 19:5541836-5541858 CTTTCTGCAGAGAGGAAGGGAGG + Intergenic
1161776333 19:6264243-6264265 CTTCCTGGGGTGGGGAGGGGTGG - Intronic
1162106151 19:8371044-8371066 CTTTCTGGGCAGATGGAGGCTGG + Exonic
1162142028 19:8590905-8590927 CTTTCTTGAGAGAGAAGGTCTGG + Intronic
1163153887 19:15429722-15429744 CTTTTTGAGGAGTGGAGAGCTGG + Intronic
1163808450 19:19415083-19415105 TTTTTTGGGGGGAGGGGGGCGGG - Intronic
1164556885 19:29260020-29260042 CTCTCTGGGGGGAGCAGGGAGGG + Intergenic
1164630061 19:29756136-29756158 CTTGCTGGTGAGATGAGAGCAGG - Intergenic
1165139474 19:33690125-33690147 CTTTGGAGGGAGAGGAGGGGAGG + Intronic
1165143887 19:33719365-33719387 CTTGCTGGGGAGATGGGGACTGG + Intronic
1165903506 19:39179571-39179593 CATTCTGGGGAGTGGCAGGCTGG - Intronic
1166218438 19:41351404-41351426 GTAGCTGGGGTGAGGAGGGCGGG + Intronic
1166377599 19:42336329-42336351 CTTACCGGGCAGTGGAGGGCCGG - Exonic
1166561359 19:43734358-43734380 CTTTCTGGGGACTGGAGGGGTGG - Intronic
1166746306 19:45143455-45143477 CTTCCTGGGGAGGGGACTGCAGG - Intronic
1166949639 19:46417988-46418010 CTTTTTGGGGAGAGGCTGGAAGG - Intergenic
1167380303 19:49134462-49134484 GTTTCTGGGGAGAGAAGCCCCGG - Intronic
1167862668 19:52297711-52297733 GTGTCTGGGAAGAGGAGGCCTGG - Intronic
1168151178 19:54449622-54449644 CTTTCTGGGGCGTGGTGCGCAGG + Intronic
1168618867 19:57860703-57860725 CTTTTTGTAGAGAGGAGGTCTGG - Exonic
925101779 2:1253221-1253243 CCTTCTGTGGGGAGGAGGGTGGG - Intronic
925607430 2:5673376-5673398 CTTCCAGGGCAGCGGAGGGCGGG - Intergenic
925965277 2:9059931-9059953 CTTTCTGGGAAGAGCAGGGCAGG + Intergenic
926221263 2:10937138-10937160 CTTTCTGGGCAGAGGGGGGCAGG - Intergenic
926562713 2:14435123-14435145 CTTTCAGCGGAGAGGGGAGCTGG + Intergenic
926618520 2:15024121-15024143 CTTACTGGAGAAAGGAGGGTGGG - Intergenic
927119367 2:19940847-19940869 CTTTTAGGGGAGAGAAGGGCAGG - Intronic
927261228 2:21093150-21093172 CTTTCTTGGCAGAGGACTGCGGG - Intergenic
927468092 2:23351786-23351808 CCTCCCCGGGAGAGGAGGGCAGG - Intergenic
927898555 2:26802077-26802099 TTTTCTGGAGAGAGGAGTGGAGG + Intergenic
928058242 2:28081115-28081137 ATAGCTGGGGAGAGGAGGGCAGG + Intronic
928116730 2:28550538-28550560 TTTTTTGGTGGGAGGAGGGCGGG + Intronic
928123153 2:28598518-28598540 CTTCCTGGGGAGAGGCAGGGAGG - Intronic
928283598 2:29970024-29970046 CTTTCTGGAGAGAGCAGGGCAGG - Intergenic
928285579 2:29987410-29987432 GTTGCTGGGGAGAGGAGAGGAGG - Intergenic
928421385 2:31139683-31139705 CTTTATGGGGAGAGAGGGGCAGG - Intronic
929601248 2:43206158-43206180 GTTTCCAGGGACAGGAGGGCTGG + Intergenic
929869356 2:45745255-45745277 CCTGGTGGGGAGAGGAGGCCCGG + Intronic
929878251 2:45814793-45814815 CTCTCTGGAGGGAGGAGGGAGGG + Intronic
930710324 2:54544924-54544946 CCTACTGGGGAGTGGGGGGCTGG - Intronic
930826798 2:55703377-55703399 CTTTTTGGGGAGAGCAGGACAGG + Intergenic
931297629 2:60944408-60944430 GATTCTGGGGAGAGGAGCGGGGG + Intronic
931604474 2:64038941-64038963 CTTGCTGGAGTGAGGAGGACAGG - Intergenic
932986943 2:76737661-76737683 CTTTCTGTGGAGAATAGGGCAGG + Intergenic
933699751 2:85245961-85245983 CTTTCTGGGCAAAGGAGAGCTGG - Intronic
933707441 2:85302580-85302602 ATCTCTGGGGAGAGGTGGGTGGG - Exonic
933822104 2:86122581-86122603 TTTTTTGGGGTGGGGAGGGCGGG + Intronic
934168454 2:89319100-89319122 CTGTCTGGGAAGCCGAGGGCTGG - Intergenic
934198833 2:89863482-89863504 CTGTCTGGGAAGCCGAGGGCTGG + Intergenic
934473668 2:94578128-94578150 CTTTCTGGGCAGAGGGTGACAGG - Intergenic
934571735 2:95376961-95376983 CTTTTTGGTGAGCGGAGGGAGGG - Intronic
935250984 2:101260471-101260493 CAATCTGGGTAGAGGACGGCAGG - Intronic
935314461 2:101817677-101817699 CTTTCCATGGAGAAGAGGGCGGG + Intronic
935634248 2:105237673-105237695 TTTCTTGGGGAGAGGAGGCCAGG - Intergenic
935736923 2:106113709-106113731 CTTTCTGGGCACCTGAGGGCAGG + Intronic
936042728 2:109161927-109161949 CCTCCTGGGGAGGGGAGGGTTGG + Intronic
936451357 2:112636133-112636155 CTTTCAGGGTAGAGGAGAGCAGG + Intergenic
937047894 2:118861862-118861884 TTTTATGGGGAGAGGATGGTGGG - Intergenic
937891253 2:126940596-126940618 AATTCTGGGCAGAAGAGGGCAGG - Intergenic
938237937 2:129721929-129721951 CTTTCTGGGGTGAGGTGGGCGGG + Intergenic
938603826 2:132872077-132872099 CTTTCTCTGGAGAGGAAAGCTGG - Intronic
938860070 2:135359015-135359037 CTTTCTGGGATGAGGAGGGCAGG - Intronic
939773667 2:146357530-146357552 CTTTCTAGAGAAAGAAGGGCAGG - Intergenic
939948880 2:148444805-148444827 CTGTCTGGGGAGCAGAGGGGTGG - Intronic
940285345 2:152027931-152027953 CTCTCTGAGGAGAGCTGGGCAGG - Intronic
940358877 2:152775998-152776020 TGTTCTGGGGTGAGAAGGGCTGG + Intergenic
940673852 2:156704856-156704878 CTCTCTGGGGAGAGCAGGGCTGG - Intergenic
941915986 2:170814260-170814282 CTGTCAGGAGGGAGGAGGGCTGG + Intronic
941927032 2:170906128-170906150 CTGTCTGGGGAGAGGAGTGGCGG - Intergenic
942493658 2:176516214-176516236 CTTTCTTGGGAGAGCAGGGCAGG + Intergenic
942816472 2:180059284-180059306 CTTTCTGGAGAGACAAGGGGAGG + Intergenic
943356926 2:186867601-186867623 CTATCTGGGGGGAGGTGGGCGGG - Intergenic
944221824 2:197310804-197310826 CTTCCTGTGGAAAGGCGGGCGGG - Intronic
944586997 2:201181226-201181248 CCTTCTTGGGAAAGGGGGGCCGG - Intergenic
945113628 2:206389367-206389389 CTTTCTGGGAAGAGTAGGGCAGG + Intergenic
946182583 2:217957382-217957404 CTTCCTGGGGACAGGACGGTGGG + Intronic
946184790 2:217974393-217974415 CTTTCTGGGGAGAGGCTGAGGGG - Intronic
946200044 2:218065964-218065986 CTCCCTGGGGACAGGAGGGGTGG + Intronic
946411686 2:219518359-219518381 CATTCTGGGTGGAGGAGAGCTGG + Intronic
946412422 2:219522010-219522032 TTTTCTAGGAAGAGGTGGGCAGG + Intronic
946811541 2:223530787-223530809 CTTTCAGAGGAGAGGAGAGCTGG - Intergenic
947469449 2:230387046-230387068 CTTGCGTGGGAGAGGAGGGGAGG + Intronic
947544452 2:231001155-231001177 CTTTTTGGGAAGAGGAAGGAAGG - Intronic
948112215 2:235465065-235465087 CTTTCCTGAGAGAGGAGGGGAGG + Intergenic
948457668 2:238114372-238114394 GTTGCTGGGAAGAGGAGGCCAGG - Intronic
948601579 2:239110801-239110823 CCTGCAGGGGAGAGGAGGGAAGG - Intronic
948747249 2:240105787-240105809 GTTTCTGGTGAAAGGAGGGAGGG - Intergenic
948994755 2:241572690-241572712 CTTTCTGGGGCCAGGAAGTCAGG + Exonic
1169036123 20:2453822-2453844 CTTTCTGGGGAGAGCAGGGCAGG - Intergenic
1169125306 20:3122987-3123009 GTATCTGGGGAGAGAAGTGCAGG + Intronic
1169256295 20:4102479-4102501 CATTCTGGGGAGAGTACAGCAGG + Intergenic
1169437099 20:5602340-5602362 CTTTCTGGGGAGTTGTAGGCAGG - Intronic
1169633199 20:7656994-7657016 CATTCTAGGGAGAGGGGGGAGGG + Intergenic
1170606390 20:17878039-17878061 CTTACTGGGGATGGGAGGGCAGG + Intergenic
1170821863 20:19760830-19760852 CTTACTGGGGAAAGGAGGACAGG - Intergenic
1170917514 20:20642041-20642063 CCTGCTTGGGAGAGGAGGACAGG - Intronic
1171005871 20:21465386-21465408 CATCCTGGGAAGAGGATGGCAGG - Intergenic
1171206264 20:23283576-23283598 CTTTCTGGGCAAGGGAGGGCAGG + Intergenic
1172104748 20:32510280-32510302 CAGTGTGGGGACAGGAGGGCTGG + Intronic
1172475038 20:35230317-35230339 ATTTTTGGGGAGAGGAAGGTTGG + Intronic
1172592134 20:36125286-36125308 GTTTCTGGGGAGTGGAGGATAGG + Intronic
1172812449 20:37658509-37658531 CTTTCTGCTGAGAGGCTGGCTGG + Intergenic
1172835307 20:37869561-37869583 CTGTCTAGGGAGAGAGGGGCTGG + Intronic
1173184548 20:40830653-40830675 CTTCCTGGGGAGAGTAGGTGGGG + Intergenic
1173207003 20:41003019-41003041 CTTTCTGGGGCTAGCTGGGCTGG + Intergenic
1173859612 20:46274271-46274293 CTTTCTGGGGCTGGGAAGGCTGG + Intronic
1173919143 20:46730996-46731018 CATTCTGGGGTGGGGAGGACTGG - Intronic
1174044595 20:47724510-47724532 CCTTCTAGGGAGCGGATGGCTGG - Intronic
1174102142 20:48135917-48135939 CTTTCTAGGGATGGGAGAGCTGG - Intergenic
1174103927 20:48148686-48148708 CTTTTTAGGGAAAGCAGGGCAGG - Intergenic
1174406922 20:50308856-50308878 CCGTCTGGGAAGAGGAGGCCGGG - Intergenic
1175267868 20:57713502-57713524 CTCTCTGGGGAGATGTGGGCTGG + Intergenic
1175305661 20:57973983-57974005 CTTCCTGGGCAGAGGAGGCAGGG - Intergenic
1175639145 20:60612486-60612508 CTTTCTAGGGATTGGATGGCTGG - Intergenic
1175848110 20:62069696-62069718 TTTTCTTGGGAAAGCAGGGCAGG - Intergenic
1175895843 20:62335266-62335288 CAGCCTGGGGAGAGCAGGGCAGG + Exonic
1175931608 20:62496321-62496343 CTGCCTGGGGAGTGGAGGACTGG + Intergenic
1176267665 20:64219058-64219080 CTTTCTTGGGAGAGGTGAGTTGG + Intronic
1176299169 21:5090541-5090563 GGTTCTGGGGAGAGGAGACCGGG + Intergenic
1177124621 21:17181204-17181226 AATTCTGGGTAGAAGAGGGCAGG + Intergenic
1177156895 21:17509952-17509974 CTTTTTTGGGAGAGGGGGACAGG - Intergenic
1177268147 21:18810397-18810419 CTTTCTGGGGAGAGGAATTCAGG - Intergenic
1177703782 21:24674185-24674207 AATTCTGGGCAGAAGAGGGCAGG + Intergenic
1177819632 21:26016925-26016947 CTTTGTGGGGGGCGGGGGGCGGG + Intronic
1178223628 21:30689397-30689419 CATTCTGGGCAGAAGAGGGCAGG + Intergenic
1178354629 21:31900283-31900305 CCAGCTGGGCAGAGGAGGGCAGG - Intronic
1179029407 21:37707310-37707332 CTTTGCGGGGACAGGAGGCCGGG - Intronic
1179643152 21:42760266-42760288 CTTTGGGAGGAGAGGTGGGCGGG + Intronic
1179731160 21:43368026-43368048 AGTGCTGGGGAGAGGAGTGCTGG + Intergenic
1179857857 21:44171407-44171429 GGTTCTGGGGAGAGGAGACCGGG - Intergenic
1180001816 21:44998534-44998556 CTCTCCGGGGAGAACAGGGCTGG + Intergenic
1181013159 22:20053998-20054020 CTTTGGAGGGGGAGGAGGGCAGG - Intronic
1181109241 22:20591671-20591693 CTGCCTGGAGAGGGGAGGGCTGG + Intergenic
1181327454 22:22060889-22060911 ATTTCTGGGAAGAGTAGGCCTGG - Intergenic
1181452702 22:23034531-23034553 CTCTTTGGAAAGAGGAGGGCTGG + Intergenic
1182915698 22:34027862-34027884 TTTTCTGGGGAAAGGAAAGCTGG - Intergenic
1183323301 22:37178031-37178053 CTTCCTGGGGAGATGAGCGCAGG - Intergenic
1183385892 22:37514420-37514442 CTTTCTGAGGAGTGATGGGCAGG - Intronic
1183511087 22:38235349-38235371 CTTTCTTGGGAGAGGACTGCAGG - Intronic
1183964467 22:41433142-41433164 ATTCCTGGGGGGAGGAGAGCGGG - Intergenic
1183971098 22:41478102-41478124 CTATCTGGGGAGATGATGGGAGG - Intronic
1184152699 22:42648045-42648067 CTTTCTGGGGAAAAATGGGCCGG + Intronic
1184251250 22:43261590-43261612 CTTTCTGTGGAGAGGACAGCTGG - Intronic
1184587979 22:45460595-45460617 CTTCCTGAGTAGAGGAGGCCTGG + Intergenic
1184599118 22:45532258-45532280 CTTTCTGGGGAGGGGAGAGCTGG + Intronic
1184875926 22:47275562-47275584 CTTTCTGTAGGGAGCAGGGCTGG + Intergenic
1185013185 22:48327890-48327912 CTTACTGGGGAGAAGAGGAGAGG - Intergenic
1185172003 22:49299632-49299654 GTGTCTGGGGAGGGGAGGGCAGG - Intergenic
949383625 3:3473797-3473819 CTTTCTGGGAAGAGCAGGGAAGG - Intergenic
949961288 3:9314633-9314655 CAGGGTGGGGAGAGGAGGGCAGG - Intronic
949961302 3:9314671-9314693 AGCACTGGGGAGAGGAGGGCAGG - Intronic
950167808 3:10814907-10814929 CTTTCTGGGGAGATGGAGGTTGG + Intergenic
950463578 3:13140072-13140094 CTTGCTGGGGTGAGGTGGGTTGG - Intergenic
950529249 3:13543616-13543638 GTGTCTGGGGAGAGGAGTGGGGG - Intergenic
950673406 3:14540365-14540387 CTCCCTGGGGAGGGGAGGGAGGG - Exonic
950718433 3:14865834-14865856 CCTTCTTGGGAGAGGAGGAGTGG - Intronic
950790877 3:15470795-15470817 CTTTCATGGAAGAGGAGGGAAGG + Intronic
950972038 3:17198695-17198717 CGTTCTGGGAAGGGCAGGGCAGG + Intronic
951200703 3:19873157-19873179 CTTTCTGGAGAGACTAGGGGAGG - Intergenic
951238663 3:20264959-20264981 CTGTCAGTGGAGAGGAGAGCTGG - Intergenic
951251096 3:20395215-20395237 AATTCTGGGAAGAAGAGGGCAGG + Intergenic
951699491 3:25480734-25480756 CTTTATTGGGAGGGCAGGGCAGG + Intronic
952846937 3:37695715-37695737 CTTGCTTGGGAGAGCAGGACAGG - Intronic
953446082 3:42968710-42968732 CTTTCTGGGGAGGGCAGGGCAGG + Intronic
953535659 3:43774925-43774947 CTTTCAGGGGAGAGCATGGATGG - Intergenic
954168081 3:48777205-48777227 CTTTTTAGAGAGAGCAGGGCAGG - Intronic
954398972 3:50309681-50309703 CTTTCTGGGGCCAGGAGTGGTGG + Intronic
954563594 3:51579401-51579423 AATTCTGGGCAGAAGAGGGCAGG - Intronic
955145392 3:56313174-56313196 ATTGCTGGGGAGAGGAGGATGGG + Intronic
955334861 3:58077027-58077049 CTATCTGGGGAGAGAAGCACAGG - Exonic
956487686 3:69739759-69739781 CACTCTGGGGCGAGGAGAGCGGG + Intronic
957414184 3:79879017-79879039 AATTCTGGGCAGAAGAGGGCAGG - Intergenic
957705126 3:83770441-83770463 ATTTCTGGGAGGAAGAGGGCGGG + Intergenic
958636299 3:96750881-96750903 CTTTCAGCAGAGAGGAGGCCTGG - Intergenic
958735442 3:98003863-98003885 CTTTCTAGAGAGAGATGGGCAGG - Intronic
960089959 3:113628890-113628912 CTTACTGGGGAGAGAATGTCAGG - Exonic
961050027 3:123738039-123738061 CTTAAGGGGGAGAGGTGGGCGGG - Intronic
961110351 3:124278291-124278313 CTTTCTGGGTGGGGTAGGGCTGG + Intronic
961614544 3:128168464-128168486 CTTTCTGGGGAGAGAGAGGAAGG + Intronic
962149903 3:132881629-132881651 CTTTCTGGGGTGAGGTGACCTGG + Intergenic
963730062 3:148962659-148962681 CCTCCTGGGTAGAGGAGGGGAGG - Intergenic
963858378 3:150280383-150280405 AATTCTGGGCAGAAGAGGGCAGG + Intergenic
964523825 3:157595734-157595756 CTGTCTTTGGAGGGGAGGGCAGG - Intronic
964790464 3:160449804-160449826 CCTTCGGGGCAGAGGAGGGCGGG - Exonic
965443888 3:168750498-168750520 CTTTCTGGGGATAGGGGGAAAGG + Intergenic
965443942 3:168751270-168751292 CTTTCTGGGGATAGGGGGAAAGG - Intergenic
965742156 3:171886718-171886740 CTTTCTGGGGAGAATATGGTAGG - Intronic
966168623 3:177051287-177051309 CTTCCTGGGGGGTGGAGGGTGGG + Intronic
966809751 3:183833134-183833156 CAGGCAGGGGAGAGGAGGGCAGG + Intronic
966970773 3:185043396-185043418 CTTTCTTGTGAGGGAAGGGCTGG - Intronic
966993118 3:185254165-185254187 GGGTCTCGGGAGAGGAGGGCTGG - Intronic
967186607 3:186949590-186949612 CTGGCTGGGGAGACAAGGGCAGG - Intronic
967997562 3:195178383-195178405 TTTTCTGGAGAGAGCAGGGCCGG - Intronic
968133110 3:196203668-196203690 CATTCTGGGCAGGGGAGGGAGGG + Intronic
968227110 3:196979683-196979705 CTTTCTCAGGAGCGCAGGGCTGG + Intergenic
968268018 3:197377574-197377596 CTTTCTAGGGCGAGGAGAGCTGG + Intergenic
968391669 4:198030-198052 CTGTGTGGGGATAGGAGGGTTGG - Intergenic
968403442 4:317908-317930 CTGTGTGGGGATAGGAGGGTTGG + Intergenic
968405213 4:335168-335190 CTGTGTGGGGATAGGAGGGTTGG - Intergenic
968506365 4:973105-973127 CTTTCGGGGGAGTGGAGGGCGGG - Intronic
968771494 4:2510438-2510460 CTTTCTAGGGAGGAGAGGCCTGG + Intronic
968942444 4:3645868-3645890 GGTTCTGGGGAGAGCAGGGGTGG - Intergenic
969227474 4:5808182-5808204 CATCCTGGGGGGAGGAAGGCAGG - Exonic
969526774 4:7707852-7707874 CTGGCTGGGGAGAGGTGAGCTGG + Intronic
970316399 4:14832180-14832202 CTTCCTGGGGTGATGAGGGTGGG - Intergenic
971427422 4:26530226-26530248 AGTTCTGGGCAGACGAGGGCAGG + Intergenic
971837785 4:31791249-31791271 CTTTTGGTGGAGAGCAGGGCAGG - Intergenic
972566703 4:40276084-40276106 CTTTGGGGGCAGAGGAGGGTGGG - Intergenic
972873637 4:43330681-43330703 CTTTCTGGAGATATAAGGGCAGG + Intergenic
973164809 4:47063878-47063900 CTGTCAGGGGAGGGCAGGGCTGG + Intronic
973249440 4:48046292-48046314 CTTTCTGAGGAGCACAGGGCAGG - Intergenic
973271677 4:48269085-48269107 CTTCCCGGGGCGAGGTGGGCGGG + Intronic
974763950 4:66316143-66316165 TTTTCTAGGCAGAGTAGGGCAGG + Intergenic
975640595 4:76496201-76496223 GCTTCTGGGGTGAGGAGGGCAGG + Intronic
977827549 4:101551698-101551720 AATTCTGGGCAGAAGAGGGCAGG + Intronic
978593833 4:110355775-110355797 AATTCTGGGCAGAAGAGGGCAGG + Intergenic
979503439 4:121466675-121466697 CTTTCTAGGGAGAGCAAGGCCGG + Intergenic
979777074 4:124603245-124603267 CTGTCAGGGGAGAGTAGGGGTGG + Intergenic
979972809 4:127158585-127158607 GTCTCTGCTGAGAGGAGGGCTGG - Intergenic
980054085 4:128062764-128062786 CTTTATGGGGGGAGGGGGGAGGG + Intronic
980100763 4:128539259-128539281 AGTGCTGGGTAGAGGAGGGCGGG - Intergenic
980970308 4:139561026-139561048 CTTTCTGGGGCGGGGAGGGGAGG + Intronic
981748021 4:148069381-148069403 CCTTCCAGGGAGGGGAGGGCTGG + Intronic
982126353 4:152187113-152187135 CTTTCTTGGGAGATGATGGAAGG + Intergenic
982326062 4:154129151-154129173 CCTTGTGGGGTGATGAGGGCTGG + Intergenic
982856745 4:160392404-160392426 CTTTCCAGAGAGAGCAGGGCTGG + Intergenic
983987233 4:174073868-174073890 AATTCTGGGCAGAAGAGGGCAGG - Intergenic
984284359 4:177710060-177710082 TTTTCTGGAGGGAGCAGGGCAGG - Intergenic
985538029 5:475364-475386 CTGTCCGGGGAGACGTGGGCCGG - Intronic
985666287 5:1183085-1183107 CTCTCTGGGGCGAGCAGGCCTGG - Intergenic
985689295 5:1298341-1298363 GGTTCTGGGAAGAGGCGGGCAGG - Intergenic
986280295 5:6316780-6316802 CTTTCTGGGTCGAGGAAGGCAGG - Intergenic
986494895 5:8332078-8332100 CTTCATGGGGAGAAGAGAGCAGG - Intergenic
986631700 5:9780316-9780338 CTTTCAGTGCAGTGGAGGGCTGG - Intergenic
986783226 5:11085984-11086006 CTTGCTGGGCTGGGGAGGGCTGG + Intronic
986994171 5:13587040-13587062 CTTTTTGAGGAGAGCAGAGCAGG - Intergenic
989213183 5:38878102-38878124 CTTTCTGGGCACAGGAGTGAAGG - Intronic
990200841 5:53371420-53371442 CTCTCAGGGGAGAGGTGGGAGGG + Intergenic
990538846 5:56752003-56752025 CTTTCTGGGGACACAAGGTCAGG - Intergenic
990793087 5:59504826-59504848 TTTTCTGGGGAGAGCAGAGCAGG - Intronic
991014584 5:61917212-61917234 CCATCTGGAGAAAGGAGGGCTGG + Intergenic
992229978 5:74654575-74654597 CTTTCTAGGCAGATGAGGGAAGG + Intronic
992692394 5:79253908-79253930 CTTTCAGGGGACAGGATGGGTGG - Intronic
992744049 5:79801925-79801947 CTCACTGGGGAGTGGAGGGCTGG - Intergenic
992903957 5:81326704-81326726 CTCTCTGGGCAGAGGAGGCCTGG - Intergenic
994049933 5:95350857-95350879 TTGTCTGGGGAGAGCAGGGCAGG + Intergenic
994188135 5:96838174-96838196 AATTCTGGGCAGAAGAGGGCAGG - Intronic
994941308 5:106327383-106327405 TTTTCTGGGGAGAGCAGGGTGGG - Intergenic
996101565 5:119450323-119450345 AATTCTGGGCAGAAGAGGGCAGG - Intergenic
996308670 5:122078420-122078442 GTGTCTGGGGGGAGGAGGGCAGG - Intergenic
996502207 5:124229958-124229980 AATTCTGGGCAGAAGAGGGCGGG + Intergenic
996804677 5:127441245-127441267 CATTCGGTGGGGAGGAGGGCTGG + Intronic
996823128 5:127652663-127652685 CCATCTGTGGAGAGGAGGGGAGG - Intronic
997428218 5:133818882-133818904 CTTTGTTGGAAGAGAAGGGCTGG - Intergenic
997811450 5:136974396-136974418 CTGGCTGGGGAGGGGAGGGAAGG + Intergenic
998015001 5:138724902-138724924 CTTTCTGGGGAGATAAGGCCAGG + Intronic
998413424 5:141928309-141928331 AGTCCTGGGGACAGGAGGGCTGG + Intronic
998725330 5:145006506-145006528 CTGTCTGGGAAGGGGAGGGGAGG - Intergenic
999202569 5:149826654-149826676 CAATCTGGAGTGAGGAGGGCGGG - Exonic
1001240627 5:170067324-170067346 CTCTCTGGGGAGAGACAGGCTGG - Intronic
1001512851 5:172335971-172335993 CTTTCTGCCTAGAGGAAGGCAGG + Exonic
1001757438 5:174181315-174181337 CTTGCTGGGTGGAGGATGGCTGG - Intronic
1002307130 5:178290466-178290488 CCTTCCGGGGAGAGGTGGCCAGG - Intronic
1002575429 5:180171281-180171303 GTTTCTGGGGAAGGGAGGGCAGG + Intronic
1002670249 5:180861047-180861069 GTTTCTGGGGAGCGGAGGGGAGG - Intronic
1003014348 6:2455994-2456016 CCTGCTGGAGAGAGCAGGGCAGG + Intergenic
1004513671 6:16303437-16303459 CATTCTGGCCAGAGCAGGGCTGG - Exonic
1004741980 6:18471173-18471195 TTTTGTGGGGAGTGGAGGGGTGG + Intergenic
1004865052 6:19845301-19845323 GTTTCCGGGGTGAGGAGGGGAGG - Intergenic
1004910302 6:20276661-20276683 CTCACTGGGGAGTGGAGGCCCGG + Intergenic
1006101537 6:31688968-31688990 CTTCCTGGGAAGGGGTGGGCTGG - Intronic
1006936641 6:37723348-37723370 CTCTCTGGGGAGGGGAGGGCTGG + Intergenic
1007175516 6:39893911-39893933 CCTGCTGGGGATAGGAGGGCAGG - Intronic
1007243125 6:40441447-40441469 CTGTGTGGGTAAAGGAGGGCTGG + Intronic
1007725451 6:43913253-43913275 GGTACTGGGGAGAGGCGGGCTGG - Intergenic
1007743734 6:44029490-44029512 GGTTCTAGGGAGGGGAGGGCAGG + Intergenic
1007818141 6:44539288-44539310 CTTTCCTGGGAGAGGAGGGGAGG - Intergenic
1008372142 6:50744944-50744966 CTTTTTGGGGGGAGGAGGGGAGG - Intronic
1009524723 6:64729203-64729225 AATTCTGGGCAGAAGAGGGCAGG - Intronic
1009553137 6:65125835-65125857 TTTTCTGAAGAGAGGAAGGCAGG - Intronic
1011207725 6:84918351-84918373 GTATCAGGGGAGAGGATGGCAGG + Intergenic
1012373850 6:98537607-98537629 CTTTCTGGGGAGAGCAGGGCAGG - Intergenic
1012585910 6:100922375-100922397 CTTTCTTGAGAGTGGAGGGTGGG + Intergenic
1012796374 6:103767768-103767790 ATTTTTAGGGAGAGGAGAGCTGG - Intergenic
1013004025 6:106053826-106053848 CATTGTGGGGGGTGGAGGGCTGG - Intergenic
1013428775 6:110037707-110037729 CTTTCTCTGGGGAGGAGGGAAGG + Intergenic
1013995666 6:116304775-116304797 CATTCTAGGCAGATGAGGGCTGG - Intronic
1014237211 6:118971810-118971832 CTTCCTGGAGAGAGAAGGGTGGG - Intronic
1015851470 6:137577855-137577877 CTTCCTGGGTAGAGGTGGTCTGG - Intergenic
1016549009 6:145255870-145255892 AATTCTGGGCAGAAGAGGGCAGG - Intergenic
1017123308 6:151044252-151044274 CTTTCTGGGCAGAGGGTGACAGG + Intronic
1017635339 6:156437585-156437607 CTTTCTGGGAAGAGGGCAGCTGG - Intergenic
1018014373 6:159698926-159698948 CTGTCTGGGGGGTGGGGGGCGGG + Intronic
1018398204 6:163397472-163397494 TGTTGTGGGGAGGGGAGGGCTGG - Intergenic
1018438811 6:163789152-163789174 TTGACTGGGGAGAAGAGGGCAGG - Intergenic
1018475442 6:164135607-164135629 CTTTCTGGGGAGAAGGGGAGAGG + Intergenic
1018629617 6:165810677-165810699 CATCCTGGGGAGAGGAAGGTAGG - Intronic
1018750341 6:166798765-166798787 CTGTCTGTGGAGAAGGGGGCAGG - Intronic
1018870459 6:167778582-167778604 ATTCCTGAGCAGAGGAGGGCCGG - Intergenic
1018898282 6:168036405-168036427 CTCTCTGGGGCGGGGAGGGGCGG - Intronic
1019323316 7:425283-425305 GTTGCTGGGGAGGGCAGGGCCGG + Intergenic
1019343843 7:520322-520344 TTTTATGGAGAGAGGAAGGCTGG - Intergenic
1019783591 7:2959239-2959261 CCTTCTGGAGAAAGGAGGCCAGG + Intronic
1020066868 7:5195051-5195073 CTCTCTGGGGAGGGTAGAGCAGG + Intronic
1020112006 7:5452541-5452563 CTCTCTGGGCAGAGCGGGGCGGG - Intronic
1020284169 7:6667496-6667518 AATTCTGGGCAGAAGAGGGCGGG + Intergenic
1021072385 7:16256756-16256778 CTTGTTGGGGAGTGGGGGGCTGG + Intronic
1021097235 7:16547864-16547886 GTTCCTGGGCAGAGGGGGGCAGG + Intronic
1021982224 7:26065960-26065982 CTTTCTTGGGAGAAGTGGGATGG - Intergenic
1023417903 7:39949929-39949951 ATTTCCGGGGAGATGGGGGCAGG - Intergenic
1024191825 7:47019840-47019862 ATCTCTGGGGAGAGCAGAGCAGG - Intergenic
1024506287 7:50165009-50165031 GTGTCTGGGCAGAGGAGGGGTGG + Intergenic
1024624084 7:51189271-51189293 CTTGGCGGGGAGAGGAAGGCTGG + Intronic
1025230722 7:57201827-57201849 CTTACTGTGGAAAGAAGGGCCGG + Intergenic
1026537022 7:71246939-71246961 CTTTTTGGGGGGAGGGGGGAGGG + Intronic
1026933295 7:74237299-74237321 CTTCTTGGGCAGAGGAGAGCGGG - Intronic
1027173844 7:75890867-75890889 CTGTCTGGGGATGGGAGGGGAGG - Intergenic
1027351552 7:77316848-77316870 CTTGCTGGCTAGAGGAGGCCAGG - Intronic
1027372812 7:77524373-77524395 ATTTCTGGGGAGAGAAAGGAAGG + Intergenic
1028590366 7:92486426-92486448 CTTTATGGTGAAAAGAGGGCAGG + Intergenic
1029096239 7:98087047-98087069 CTTTCTGGTGAGATCGGGGCTGG - Intergenic
1029200712 7:98837384-98837406 CTGTGTGGGGAGAGGGTGGCTGG + Intergenic
1030221570 7:107104328-107104350 TTTTTTGAGGCGAGGAGGGCAGG - Intronic
1030228296 7:107177182-107177204 CTATCAGAGGAGAGTAGGGCAGG + Intronic
1030293335 7:107893607-107893629 CTTTCTGAGGAGATGATGTCTGG + Intronic
1030788784 7:113697089-113697111 CTTTCTGGGGAGAGCAGGGCAGG + Intergenic
1031084594 7:117289995-117290017 TTTTCTGAGATGAGGAGGGCTGG + Intronic
1031196476 7:118620899-118620921 CCTGTTGGGGAGTGGAGGGCTGG - Intergenic
1031529317 7:122856994-122857016 CCTTATGGGGAGAGGAGGGCTGG - Intronic
1032080607 7:128856693-128856715 CCTTCTGGGGAGGGGAAGGATGG + Intronic
1032630538 7:133646035-133646057 CTGTTTGGGGAGAGGAGGAGAGG - Intronic
1033050177 7:137997030-137997052 CTTTAGGGGGAGAGGTTGGCAGG - Intronic
1033476805 7:141700856-141700878 CTTTCTGGGATGAGGTGGGATGG - Intronic
1033587585 7:142786106-142786128 CTTTGAGGGGAGTGGAGGGTGGG - Intergenic
1034164419 7:149014554-149014576 CTTCATGGGGAGGGGAGGGGAGG - Intronic
1034165260 7:149020583-149020605 CTTTGAGGGAAGAGGAAGGCAGG + Intronic
1034634451 7:152556055-152556077 CTTTCTGGTGTGAGGAGCCCTGG + Intergenic
1034999720 7:155603188-155603210 GTCTCTGGAGAGTGGAGGGCAGG - Intergenic
1035122068 7:156577002-156577024 CTGTCTGGGGAGGTGAGGGTCGG + Intergenic
1035184063 7:157112079-157112101 CGTTCTGGGCAGAGGAGGGCAGG - Intergenic
1037403366 8:18515854-18515876 CTTTGTGAGGAGATGAAGGCTGG + Intergenic
1037800374 8:22031266-22031288 ATTTTTGAGGAGAAGAGGGCTGG + Intronic
1037808642 8:22072787-22072809 CTTTCTGGGGACAGAAGTTCTGG + Intronic
1037920509 8:22802257-22802279 CTTTCTGGGTGGAGGTTGGCAGG + Intronic
1037991210 8:23322422-23322444 CTCTCTGGGGAGAAGAGGCTTGG - Intronic
1038209244 8:25500027-25500049 CTTTTTTGGGAGAGGTGGGGTGG + Intronic
1038948792 8:32391122-32391144 TTTTTTGGGGGGAGGGGGGCTGG + Intronic
1039462173 8:37754262-37754284 CTTTCTAGGGAAAGGAGGGTGGG + Exonic
1039470301 8:37809346-37809368 CTATCTGGGGAGAGGAGGGCAGG - Intronic
1039766829 8:40637498-40637520 CTTTCTGGGGAGACAAGGAGTGG - Intronic
1040392179 8:46959656-46959678 ATTTGGGGGGAGAGGAGGGAAGG + Intergenic
1041398001 8:57411494-57411516 CTTTCTGGGAAGAGGAGGACAGG - Intergenic
1041466120 8:58159263-58159285 CCTTCTGGGAGGTGGAGGGCAGG - Intronic
1041771016 8:61472327-61472349 GTTTCTGGAGAGGGGAGGGAAGG + Intronic
1041957981 8:63577554-63577576 CTCTCCTGGGAGAGGTGGGCTGG + Intergenic
1042188135 8:66157195-66157217 CTGCCTAGGGAGAGGAGGGTGGG + Intronic
1042396741 8:68300249-68300271 GTTGCAGGGGAGAGGAGGACAGG + Intergenic
1043078015 8:75727114-75727136 TTTTCTAGGCAAAGGAGGGCTGG + Intergenic
1045300696 8:100907966-100907988 CTCTCAGGGGAGAGGAGACCCGG + Intergenic
1045335910 8:101204914-101204936 CGTTTTGGGGAGAGGAGAGGAGG + Exonic
1045468698 8:102491844-102491866 CTTTCTGGGGAGGGCAGGCATGG + Intergenic
1045617669 8:103937601-103937623 ATTGCTGTGCAGAGGAGGGCAGG + Intronic
1046163744 8:110401336-110401358 ATATCTGGGGAAAGCAGGGCAGG + Intergenic
1047563751 8:126017815-126017837 CTTTCTGAGGATAGCAAGGCAGG + Intergenic
1047693127 8:127376979-127377001 TCTTTTGGGGAGGGGAGGGCGGG - Intergenic
1047756910 8:127926112-127926134 CACTCTGGGGAGAAGAGAGCCGG - Intergenic
1048277056 8:133074636-133074658 AATTCTGTGGAGAGAAGGGCTGG - Intronic
1048445524 8:134490036-134490058 CCCTCTGGGGAGGGGAGGACTGG - Intronic
1048502602 8:134992401-134992423 CTTTCTGAGGAGGGAAAGGCTGG + Intergenic
1048572559 8:135667696-135667718 GTTCCTGGGAAGAGGAGGCCAGG + Intergenic
1048829506 8:138462551-138462573 GTCACTGGGGAGAGGAGGGCAGG + Intronic
1049255217 8:141610117-141610139 ATATCTGGGGAGAGAAAGGCAGG - Intergenic
1049368265 8:142251324-142251346 TTTTGTGGGGGGAGGGGGGCGGG - Intronic
1049735474 8:144202643-144202665 CTCTCTGTGGAGAGGCGGGGAGG + Intronic
1049804668 8:144533495-144533517 GTTTGGGGGGCGAGGAGGGCTGG - Intronic
1052803234 9:32989477-32989499 GTCCCTGGGGAAAGGAGGGCAGG + Intronic
1052893982 9:33730517-33730539 CTTTTTGTGGAGTGAAGGGCGGG + Intergenic
1053131042 9:35615915-35615937 CGCTCTGGGGAGAGGAGAGAAGG - Intronic
1053684662 9:40510384-40510406 CTTTCTGGGCAGAGGGTGACAGG + Intergenic
1053934628 9:43138662-43138684 CTTTCTGGGCAGAGGGTGACAGG + Intergenic
1054279064 9:63114581-63114603 CTTTCTGGGCAGAGGGTGACAGG - Intergenic
1054297756 9:63345846-63345868 CTTTCTGGGCAGAGGGTGACAGG + Intergenic
1054395772 9:64650357-64650379 CTTTCTGGGCAGAGGGTGACAGG + Intergenic
1054430416 9:65155552-65155574 CTTTCTGGGCAGAGGGTGACAGG + Intergenic
1054499964 9:65865969-65865991 CTTTCTGGGCAGAGGGTGACAGG - Intergenic
1054901371 9:70372596-70372618 TTTTCTGGGGACAGCAGGGCAGG - Intergenic
1055156132 9:73065425-73065447 CTTTCAGTGGAAAGGAAGGCTGG - Intronic
1055658742 9:78479447-78479469 CTTTCTGGGGAGGGCAGGGCTGG + Intergenic
1056030607 9:82549476-82549498 CTTCCTGAGGAGAGTAGGGCAGG + Intergenic
1056177316 9:84048110-84048132 TTTTCTGGGGGGAGGGGGGAGGG + Intergenic
1056211606 9:84369806-84369828 CTTACTGGAGGGTGGAGGGCTGG - Intergenic
1056440540 9:86616643-86616665 CTTTATGAGAAGAGGAGGTCAGG - Intergenic
1056761996 9:89422356-89422378 CTTTCTGGCTTGGGGAGGGCAGG + Intronic
1056816786 9:89807636-89807658 TTTTGTGGGCAGAGGAGGGCAGG + Intergenic
1057023843 9:91721323-91721345 CTGTCTGGGAGGAGAAGGGCGGG - Intronic
1058111589 9:101036183-101036205 CTTTGTGGAAAGAGCAGGGCTGG - Intronic
1058251278 9:102698345-102698367 ATTTGTGGGGAGTGGAGGGCAGG + Intergenic
1058676301 9:107403103-107403125 CTTTGTGGGAAGAGAAGGGGAGG + Intergenic
1058882973 9:109301463-109301485 CTTTCTGGGGAGATGAGAAGGGG - Intronic
1060488181 9:124062710-124062732 CTGTCTTGGGCCAGGAGGGCAGG + Intergenic
1060589433 9:124807762-124807784 CTGCCTGTGGGGAGGAGGGCAGG - Exonic
1060742112 9:126105870-126105892 CTTTCTGGGGTGAGAAGCGAAGG - Intergenic
1060790767 9:126484042-126484064 CCATCAGGGGAGGGGAGGGCAGG + Intronic
1060946827 9:127574618-127574640 GTTTGTGGGGAGAGCAGAGCTGG - Intronic
1061160736 9:128892501-128892523 CTTCCTGGGGAGAGGAAGAGGGG - Intronic
1061226305 9:129282976-129282998 CTTTGTGGGGAGGGCAGGGGTGG - Intergenic
1061442238 9:130613429-130613451 CTTTGTGGGAAGAGGATAGCTGG + Intronic
1061746733 9:132745652-132745674 CTTTCCGGGTAGTGGAGGGGAGG + Intronic
1062070665 9:134553502-134553524 CAGGCTGGGGAGAGGAGAGCAGG + Intergenic
1062220608 9:135413239-135413261 CCTTCTCGGAAGAGGAGGGGAGG - Intergenic
1062392123 9:136338057-136338079 CCTTCTGGGGAGGGGAGGGGAGG - Intronic
1062479018 9:136742963-136742985 CTGTGTCGGGAGAGGAGGGAGGG + Intronic
1203435879 Un_GL000195v1:136751-136773 CCTTCTGGGGAGACTAAGGCAGG + Intergenic
1185790028 X:2922293-2922315 CTTTCTGGGGAGAGCAGGGCAGG + Intronic
1185953602 X:4464529-4464551 CTTTCTAGGAAGGGCAGGGCGGG + Intergenic
1186102628 X:6173151-6173173 CTCCCTGTGGAGAGGAGGGAAGG + Intronic
1186128674 X:6443089-6443111 AATTCTGGGCAGAAGAGGGCGGG - Intergenic
1186383794 X:9088951-9088973 CTTTCTGGTGAAAGTAGGACAGG + Intronic
1187553815 X:20332192-20332214 CTTGCAGAGGAGAGGAGGGGAGG - Intergenic
1188554841 X:31399566-31399588 AATTCTGGGCAGAAGAGGGCAGG - Intronic
1188853111 X:35156496-35156518 CTTTTTGGGGAGAGCAGGACAGG + Intergenic
1189119457 X:38378819-38378841 CTTTCTGGGGATAGTAGGTCTGG + Intronic
1189394712 X:40610758-40610780 CTTAATGGGGAGAGAAGGGAGGG + Intergenic
1190138859 X:47823169-47823191 GTTTCTGGCAAGAGGAGGGCAGG + Intergenic
1190325584 X:49205081-49205103 CCTGCTGGGGAGGGGAGGGCAGG + Exonic
1190575637 X:51834395-51834417 CTTTCTGCAGAGAGCAGGGGTGG - Intronic
1190596159 X:52053968-52053990 GTATCAGGGGAGGGGAGGGCGGG - Intronic
1190612665 X:52200105-52200127 GTATCAGGGGAGGGGAGGGCGGG + Intronic
1191215707 X:57930632-57930654 TTTTCTGGGGAGTGGAGGGAAGG + Intergenic
1191690318 X:63932648-63932670 ATTTCTGGCTAGAGGTGGGCTGG + Intergenic
1192292437 X:69811739-69811761 TTTTCTGGAGAGAGCAGGGATGG + Intronic
1192358091 X:70422295-70422317 CTGTCTGGGGTGATGAGGGAAGG + Intergenic
1192425259 X:71069239-71069261 TTTTTTGAGTAGAGGAGGGCAGG - Intronic
1193468385 X:81872854-81872876 CTTTCTGGGGTGAGGTGGGGTGG - Intergenic
1193713511 X:84907825-84907847 CTTTCCGGGGAGAGCAAGACAGG + Intergenic
1194672158 X:96747142-96747164 CTTTTTGGGGAGAGGGGTGTTGG + Intronic
1194939038 X:99987304-99987326 CTTTGAGGGGAAAGTAGGGCTGG - Intergenic
1195578765 X:106478675-106478697 CTTTCAGAGGAGAGAAGGGCAGG + Intergenic
1196873142 X:120131510-120131532 CTTTCAGTGGAGAGGGGAGCTGG + Intergenic
1196943998 X:120806120-120806142 GTTTCTGAGGAGAGTAAGGCAGG + Intergenic
1197734619 X:129841694-129841716 CTTTCTGGGGAGTTTGGGGCTGG - Intronic
1198299793 X:135324073-135324095 CTTTCTGGGGAGAGGAGGGCAGG + Intronic
1198482759 X:137056081-137056103 CTTTCTTGGGAGGGCAGGGCAGG + Intergenic
1198911894 X:141624362-141624384 CTTTCTGGGGAGATCAGGACAGG - Intronic
1199336996 X:146630165-146630187 AATTCTGGGCAGAAGAGGGCAGG + Intergenic
1199840193 X:151638287-151638309 CCTTTTGGGGAGTGGGGGGCTGG + Intronic
1200239306 X:154485646-154485668 AATCCTGGGGAGAGAAGGGCAGG + Exonic