ID: 1198300743

View in Genome Browser
Species Human (GRCh38)
Location X:135332117-135332139
Sequence GAGCAGCAGGTAGGCCAAGA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 377
Summary {0: 1, 1: 0, 2: 5, 3: 33, 4: 338}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1198300743 Original CRISPR GAGCAGCAGGTAGGCCAAGA AGG Intronic
900356647 1:2268214-2268236 GAGCAGCAGGGAGGCGACGCCGG - Intronic
900385494 1:2408731-2408753 GTCCAGCAGGTAGGGCAGGACGG + Exonic
900611504 1:3546490-3546512 GAGCAGCCTGTGGGCCAGGAAGG + Intronic
900935532 1:5764130-5764152 GAGCAGGAGGACGGCCCAGATGG + Intergenic
901154401 1:7125708-7125730 GAGCAGCATGTAGGGTGAGAGGG + Intronic
902228106 1:15009391-15009413 GAGCACCAGGAAGGCCAGGAGGG + Intronic
903016356 1:20364685-20364707 GAGCAGCAGGGAACCCTAGATGG + Intergenic
903299832 1:22370862-22370884 GAGCAGCAGGGAAGCCAGCATGG + Intergenic
905294803 1:36947394-36947416 GAGCTGCAGGAAGGAGAAGATGG - Intronic
906073617 1:43035881-43035903 GAGAACCAGGCAGGCCCAGAGGG - Intergenic
906219996 1:44071067-44071089 GAGGAGCAGTTAGGACATGATGG - Intergenic
906258018 1:44365522-44365544 GAGCAGCAGCAGTGCCAAGAAGG - Intergenic
907401245 1:54226200-54226222 GAGAGGCAGGGAGGCCAGGACGG + Intronic
907539201 1:55196849-55196871 GAGCAGCAGGGAGGCCAGTATGG - Intronic
907670726 1:56472844-56472866 GAGCAGGAGGCAGGACAAGGTGG + Intergenic
908452491 1:64269695-64269717 GAGCAGCAGGGAGGCAAAGGAGG - Intergenic
908674294 1:66585097-66585119 GAGCAGGAGATAGACCCAGAGGG - Intronic
908695288 1:66833002-66833024 GAGCAGCAGAGTGGCCAAGGGGG + Intronic
910124852 1:83829414-83829436 GCGCAGCAGGCAGGACAAAAAGG - Intergenic
911118865 1:94275017-94275039 GAGCAGCATGTAGAGCAAGTGGG + Intronic
911206586 1:95097538-95097560 GAAAAGGAGGTAGTCCAAGATGG + Intergenic
915844568 1:159250841-159250863 GAACAGGAGGGTGGCCAAGATGG + Intergenic
915892241 1:159782889-159782911 GTGCAGCAGGTGGGCCTACACGG - Intergenic
917284557 1:173410753-173410775 TAGCAGCAGGTAGGAAATGATGG - Intergenic
917964301 1:180168854-180168876 GGGCAGCAGGCAGGGCAACAGGG - Intronic
919750899 1:201037529-201037551 GAGAAGTAGGCAGGCCAAGGGGG + Intergenic
920110330 1:203582945-203582967 GACCAGCAGGCTGGCCAGGAAGG - Intergenic
920200221 1:204255612-204255634 GATCAGCAGGTAGGCAGAGCTGG - Intronic
921070264 1:211652553-211652575 TGGCAGCAGGCAGGCCAACACGG + Intergenic
921158813 1:212458558-212458580 GATCAGCAGGGAGGCAGAGAGGG - Intergenic
921851411 1:219935999-219936021 GACTAGCAGGTAGGTCATGATGG - Intronic
922164931 1:223107636-223107658 GAGCAGCAGGTGGGACAGGAGGG + Intergenic
922731467 1:227950605-227950627 AGGCAGCAGGTAGGCCACGGTGG - Intergenic
923138616 1:231140948-231140970 GAGCAGCAAGGAGGCCAGAAGGG + Intergenic
1064006396 10:11702648-11702670 GACAAGCAGGTTGGCCAGGAGGG + Intergenic
1064382661 10:14860620-14860642 GAGCAGCAGGGAGGGTAACAGGG + Intronic
1064388603 10:14921738-14921760 GAGGAGAAGCTGGGCCAAGATGG - Intronic
1064533261 10:16331873-16331895 GAACAACAGGAAGGCCAACATGG + Intergenic
1065372919 10:25008524-25008546 AAGCAGAAAGTAGTCCAAGAAGG + Intronic
1065586790 10:27226580-27226602 GGGCAGCATGTGGCCCAAGACGG + Intronic
1065877250 10:30008081-30008103 GAGCAGCCACAAGGCCAAGAGGG - Intergenic
1067448363 10:46366818-46366840 CAGCAGCTGGAAGGCCAAGAGGG + Intergenic
1067589014 10:47493948-47493970 CAGCAGCTGGAAGGCCAAGAGGG - Intergenic
1067636139 10:48002039-48002061 CAGCAGCTGGAAGGCCAAGAGGG - Intergenic
1068422702 10:56817305-56817327 GAGCAGCACGATGGCAAAGAAGG - Intergenic
1068861913 10:61855993-61856015 GAGCAGCAAGAAGGCCAATGTGG + Intergenic
1068984049 10:63090761-63090783 GAGCAGCAGGTAGGAACTGAAGG - Intergenic
1069606428 10:69741667-69741689 GAGCAGCTGATAGGGCAGGAGGG + Intergenic
1069917981 10:71798839-71798861 AGGGAGCAGGAAGGCCAAGAAGG + Intronic
1070132700 10:73666044-73666066 CAGCAGCTGGAAGGCCAAGAGGG - Intergenic
1070779802 10:79130951-79130973 GAGCAGGAGGAAGACAAAGAGGG - Intronic
1071058951 10:81547843-81547865 GAGTATGAGCTAGGCCAAGATGG + Intergenic
1071562391 10:86654654-86654676 AAGCAGCGGGTAGGCTAAGCAGG + Exonic
1071608985 10:87018030-87018052 CAGCGGCTGGAAGGCCAAGAGGG + Intergenic
1074039448 10:109773673-109773695 GAGAAGCAGGCAGACCAAGCTGG - Intergenic
1075214683 10:120521807-120521829 GAGCAGCAGCTATGCCAAAATGG + Intronic
1075788758 10:125068531-125068553 GGGCAGCAGGAAGGCCAGGAAGG + Intronic
1076024708 10:127101705-127101727 CAGCAGCAGGTGGGCCATAAAGG + Intronic
1076279057 10:129229959-129229981 GAGCAGCAGGAGAGGCAAGAGGG - Intergenic
1077170173 11:1162574-1162596 GAGCAGCAGCTACACCAAGGTGG + Exonic
1077860220 11:6171334-6171356 GAGTGGCAGGCAAGCCAAGAAGG - Intergenic
1078570006 11:12449541-12449563 GAGCAGCAGTAAGTCCATGAAGG - Intronic
1082847253 11:57736435-57736457 GAGCCACAGGTTGGACAAGAAGG + Intronic
1082899313 11:58228387-58228409 GAGCTGCAGGGAGGGGAAGAGGG + Exonic
1082948736 11:58788404-58788426 GACCTGTAGGTAGACCAAGATGG + Intergenic
1083896667 11:65623544-65623566 CAGCAGCAGGTAGCCCAGGAAGG - Exonic
1084157647 11:67323107-67323129 CTGCAGCATGCAGGCCAAGATGG - Intronic
1084423338 11:69071453-69071475 GAGCTGCCGGGAGGCCAAGCAGG + Intronic
1085464183 11:76713066-76713088 CAGCAGCAGGGAGGCCTTGAAGG + Intergenic
1085562627 11:77486361-77486383 GAGGAGGAGGTGGGGCAAGATGG + Intergenic
1085682912 11:78594966-78594988 GAGCAGTGGGTAGGTCCAGATGG - Intergenic
1086241061 11:84692216-84692238 GAGCAGGAGGTAGGAAAGGAAGG - Intronic
1086942705 11:92814994-92815016 GAACATCATGTAGTCCAAGAGGG + Intronic
1087782635 11:102317563-102317585 GGGCAGCAGGTGGGCAAGGAAGG + Exonic
1087793946 11:102435867-102435889 GAACAGCAGGTAGGATAAGGGGG + Intronic
1088255902 11:107903418-107903440 GAGCCACCGCTAGGCCAAGAAGG + Intronic
1090041877 11:123298999-123299021 GCACAGGAGGGAGGCCAAGAAGG + Intergenic
1090074649 11:123572766-123572788 GAGGCGCAGGTAGGCCCCGATGG + Intronic
1090074659 11:123572797-123572819 GAGGCGCAGGTAGGCCCCGATGG + Intronic
1090074739 11:123573045-123573067 GAGGCGCAGGTAGGCCCCGATGG + Intronic
1090965100 11:131591383-131591405 CAGCAGCAGATAGACCAAGCAGG - Intronic
1091183065 11:133624894-133624916 GAGCAGCAGGTTTGCAAATAGGG - Intergenic
1091805475 12:3353000-3353022 GAGCAGGAATTAGGCAAAGAAGG + Intergenic
1093034480 12:14320186-14320208 GAGCAGCCGGTAGGCCCTGCCGG + Intergenic
1093873792 12:24325460-24325482 AAGCAGCAGGAAGACCAAGATGG + Intergenic
1094608024 12:31966232-31966254 GGGCAGCATGCAGCCCAAGACGG - Intronic
1094832004 12:34304580-34304602 AAGCGGCAAGAAGGCCAAGAAGG + Intergenic
1095379561 12:41573707-41573729 GAGCGGCAGTGAGGGCAAGAAGG + Exonic
1096194545 12:49641584-49641606 GAGCAGCAGGAGGGCCCAGCTGG + Exonic
1097153456 12:56995877-56995899 GGGCAGCAGGAAGCCCAGGATGG - Exonic
1097993908 12:65866468-65866490 TAACAGCAGATAGGACAAGAGGG + Intronic
1098493098 12:71105085-71105107 GAGAAGCAAGTATTCCAAGAGGG - Intronic
1098944843 12:76578367-76578389 GAGCAGCAGCCTGGCCAACATGG + Intergenic
1098963400 12:76762532-76762554 GAGCAGCAGTTACTCAAAGAGGG - Intergenic
1102463038 12:113112072-113112094 GAGCACCAGGTGCGCCAGGATGG - Exonic
1102471937 12:113164146-113164168 GAGCAGCAGGAGGGCCCAGTGGG - Exonic
1102683129 12:114704029-114704051 GAGGAGCAGGTGGGCAGAGAGGG - Intergenic
1103738312 12:123074818-123074840 GAGCACCAGGGAGGAAAAGAGGG + Intronic
1103772079 12:123335189-123335211 CAGCAGCTGGGAGGCCAAGGTGG + Intronic
1105207937 13:18238744-18238766 GAGAAGCAGAAAGGCCAGGAGGG - Intergenic
1105273874 13:18903713-18903735 GAGCAGCAGGAATGGCGAGAAGG - Intergenic
1105448392 13:20476605-20476627 GAGCAGCAGGGAGCCCAAGCCGG + Intronic
1107679109 13:42829539-42829561 GAGCAGCAAGGAGGCCAATGTGG - Intergenic
1107782329 13:43917020-43917042 GTGCAGCAAGTAGTCCAAGGAGG - Intergenic
1110082658 13:71335784-71335806 GAAGAGCAGGTAGACCCAGAGGG + Intergenic
1111561113 13:89948181-89948203 GAGCAGCTTGTAGGCCAAAAAGG + Intergenic
1111784769 13:92772370-92772392 GAGCTGCAGGGAGGCCAACTGGG - Intronic
1116617224 14:47154716-47154738 GTACAGCAGAGAGGCCAAGATGG + Intronic
1118038408 14:61892536-61892558 GAGCAGCAGGCAGGTCACCACGG - Intergenic
1118473804 14:66099083-66099105 GAGCAGAAGGAAGGCATAGAGGG - Intergenic
1119137979 14:72238277-72238299 GGGGAGCGGGTAGGCCAAAAAGG + Intronic
1119783855 14:77297895-77297917 GAGCAGCCAGGAGGCCAGGAAGG - Intronic
1121586328 14:95065452-95065474 GAGCCGCAGGGAGCCCAGGAAGG - Intergenic
1122556048 14:102580618-102580640 GAGCATCAGGGAGGCCAGGCGGG + Intergenic
1124620401 15:31270726-31270748 GAGGAGCAAATGGGCCAAGAGGG + Intergenic
1125769277 15:42154247-42154269 GAGCATGAGGTAGGACAGGAGGG + Intronic
1126043251 15:44613260-44613282 AAGCAGAAGGAAGGCCAAAAAGG - Intronic
1126943391 15:53790909-53790931 GAGCAGCCTGTAGGTCAACAAGG + Intergenic
1129033978 15:72638874-72638896 GATCAGCACGCTGGCCAAGATGG + Intergenic
1129118427 15:73379705-73379727 GAGGAGCAGGTGGGTGAAGAGGG - Intergenic
1129215904 15:74098342-74098364 GATCAGCACGCTGGCCAAGATGG - Intergenic
1129733045 15:77942674-77942696 GATCAGCACGCTGGCCAAGATGG - Intergenic
1130014192 15:80174697-80174719 GGGCAGCAGACAGGCCGAGATGG - Intronic
1130153756 15:81332469-81332491 CAGCAGGAGGAAGGCCAAGTCGG - Exonic
1133450897 16:5903293-5903315 GCACAGCAGGGAGGGCAAGAGGG - Intergenic
1133707633 16:8370275-8370297 GGGCAGTAGGTAGGTCATGAGGG - Intergenic
1135533593 16:23275519-23275541 GAGCAGAAGGCAAGCCATGATGG + Intergenic
1136536060 16:30900215-30900237 GAGCAACAGTTATCCCAAGAGGG + Intronic
1137314351 16:47300447-47300469 GGGCAGCAGGTAAGGAAAGAAGG + Intronic
1137675456 16:50301733-50301755 GGGCAGCAGACAGGCCAAGGCGG - Intronic
1137677433 16:50310778-50310800 GAGCACCAGGTAGGCCACCAGGG - Exonic
1138470791 16:57234142-57234164 GAGCAGCAAGGAGGCCAGGGTGG - Intronic
1139101100 16:63767896-63767918 GAGAAGGAGGAAGGCAAAGATGG + Intergenic
1139605549 16:68015690-68015712 GCGCAGCAGGTAGGCATACAGGG - Intronic
1139621452 16:68147659-68147681 GAGCAACAGGTATACCAAAAAGG + Intronic
1140797467 16:78452969-78452991 GAGGATCACTTAGGCCAAGAAGG - Intronic
1140976150 16:80062086-80062108 GAGGAACAGGGAGGCCAAGGAGG + Intergenic
1141647618 16:85376029-85376051 TAGCAGAAGGGAGGCCAAGTTGG - Intergenic
1142762960 17:2052057-2052079 GACCAGCAGCTTGGCCAAGAGGG + Intergenic
1143237988 17:5419647-5419669 GGGGAGCAGTTGGGCCAAGATGG - Exonic
1146977715 17:37129818-37129840 GAGCCTTAGGTAGGCCATGAGGG + Intronic
1147679009 17:42227575-42227597 GAGCACCAGGTGGGGGAAGATGG - Exonic
1147686654 17:42289954-42289976 GAGCACCAGGTGGGGGAAGATGG + Exonic
1147967654 17:44201859-44201881 CAGGTGAAGGTAGGCCAAGAAGG + Intergenic
1148863897 17:50618795-50618817 GAGCAACAAGGAGGCCAAGGAGG + Exonic
1148994833 17:51700563-51700585 GAGCAGATGGAAGGCCATGAGGG - Intronic
1151028029 17:70702833-70702855 GAGCAGAAGGTATGCAAAGGTGG - Intergenic
1151273309 17:73013610-73013632 GGGCAGCAGGTGGCCCAGGACGG + Intronic
1151948079 17:77330224-77330246 GAGCAGCAGGTGCTCCAAGAGGG - Intronic
1153133809 18:1889368-1889390 GAGCACCAAGAAGGCCAAGCTGG + Intergenic
1154173768 18:12068403-12068425 GAGCAGCACGTACGCCAAGAGGG - Intergenic
1154346862 18:13549824-13549846 CAGCAGCAGACAGGTCAAGAAGG + Intronic
1155229328 18:23757499-23757521 GAGCTGGAGCGAGGCCAAGAAGG - Intronic
1157906649 18:51575144-51575166 GAGAAGCAGGGAAGCCAATAGGG + Intergenic
1160071042 18:75628046-75628068 GAGCAGGAGGAAGGAGAAGAGGG + Intergenic
1160256268 18:77250787-77250809 GAAGAGCAGGTAGGCCAGGTCGG - Exonic
1161342893 19:3752619-3752641 GTGCAGCAGGTTGGCGATGACGG + Exonic
1162467165 19:10849151-10849173 GAGCAGCAAGGAGGCCATCATGG - Intronic
1162567110 19:11450693-11450715 GAGCCACAGGCAGGCCCAGAGGG - Exonic
1162671725 19:12263527-12263549 CAGCACCTGGCAGGCCAAGATGG + Intronic
1162966161 19:14157113-14157135 GTGCAGCAGGCCGGCGAAGATGG + Exonic
1163233751 19:16019696-16019718 GAGGAGCAGGAAGGCCGAGTAGG + Intergenic
1163631404 19:18419642-18419664 GAGCAGCATGTACGCCAAGGGGG + Exonic
1163669325 19:18618204-18618226 GACCAGCAGCAAGGCCAAGGTGG + Exonic
1164538223 19:29102756-29102778 GAGCAGCAGGAAGGGAGAGATGG - Intergenic
1165334075 19:35156870-35156892 CAGGAGCAGGGAGCCCAAGAAGG + Intronic
1165577938 19:36837755-36837777 GAGCAGCAGGTTGGGGTAGAGGG - Intronic
1167782247 19:51606377-51606399 GAGCAACAGAGATGCCAAGAAGG - Intergenic
1168519798 19:57040302-57040324 GGGCACCAGGTAGGCCAGGTTGG - Intergenic
925004323 2:429285-429307 GAGCAGGAGGAAGAGCAAGAAGG - Intergenic
925614760 2:5734783-5734805 GAGCAGCAGCTAGGTCCGGAAGG + Intergenic
925778271 2:7356147-7356169 GAGCAGCAGGCAGGCCCCAAAGG - Intergenic
929128174 2:38539460-38539482 CAGCAGCAGGTGAGCCAAGGAGG + Intergenic
930216371 2:48701401-48701423 GAACAGCAAGGAGGCCAATATGG - Intronic
931669227 2:64631509-64631531 GAGCAGCAGGGGGGCCCCGAAGG - Intergenic
932895707 2:75637597-75637619 GAGCAGCAGGGATGCAGAGAAGG - Intergenic
934506180 2:94896583-94896605 AAGCAGTACGTAGACCAAGAGGG + Intergenic
934553520 2:95276093-95276115 CAGCAGCAGGAAGACCATGAGGG - Exonic
935734821 2:106098053-106098075 GACTGGCAGGTAGGCCAAGGAGG - Intronic
936628915 2:114179006-114179028 GAGCAGCAGGGCTGCCAGGAGGG + Intergenic
936912222 2:117604795-117604817 GAGCAGCAGGTAGGAACAGTAGG + Intergenic
937377505 2:121347706-121347728 CAGCAGCAGGTAGCCCCAGCTGG - Intronic
937976055 2:127582676-127582698 GGACAGCAGGTGGCCCAAGAAGG - Intronic
939709564 2:145500314-145500336 CAGCAAAAGGTAAGCCAAGAAGG - Intergenic
940482449 2:154252419-154252441 GAGCTTGCGGTAGGCCAAGATGG - Intronic
942694432 2:178624358-178624380 GAAATGCAGTTAGGCCAAGAAGG + Intronic
943858377 2:192828236-192828258 GCACAGGAGGGAGGCCAAGAGGG + Intergenic
946419987 2:219559297-219559319 GAGCAGCAGGTAGCACCAGGCGG + Exonic
947523621 2:230865824-230865846 GGGGAGCAGGGAGGCCCAGACGG - Intronic
948209586 2:236182996-236183018 GAGAAGCAGGGAGGGAAAGAAGG - Intergenic
948940040 2:241190956-241190978 GAGCGGCAGGCAGGGCCAGAGGG - Intronic
1168818909 20:760540-760562 GATCAGCAGGTGGCCCAGGAGGG + Exonic
1168897601 20:1334580-1334602 GAGCAGGAGCTTGGCAAAGAGGG + Intronic
1171220652 20:23393947-23393969 GAACAGCAAGGAGGCCAGGATGG + Intronic
1171450183 20:25230256-25230278 AAGCAGCAGTGAGGCCTAGAGGG - Intergenic
1173914976 20:46700627-46700649 GAAGAGCAGGGAGGCCAGGATGG - Intergenic
1174059818 20:47825108-47825130 CAGCAGCTGGCAGGGCAAGAGGG + Intergenic
1174630703 20:51954500-51954522 CAGCATCTGGGAGGCCAAGATGG - Intergenic
1175047977 20:56125359-56125381 GAGCAGCAGGGAAGCCAATTTGG + Intergenic
1175168511 20:57063209-57063231 TGGCAGCAGGTAGGCCATGGGGG + Intergenic
1175521927 20:59607365-59607387 GAGCAGCAGGTGGACAAATAAGG - Intronic
1176160645 20:63646146-63646168 GAGCAGCACAGAGCCCAAGAGGG + Intronic
1176183609 20:63765993-63766015 GGGCAGCAGGTGGGCCCAGCGGG - Intronic
1176183773 20:63766966-63766988 GAGCAGCAGGTGGGCTCAGGAGG - Intronic
1176822833 21:13676017-13676039 GCGCAGCAGGAACGCCATGATGG - Intergenic
1177262517 21:18749299-18749321 GAGCAGCAGGAAGGCAAAGAGGG + Intergenic
1178102381 21:29283680-29283702 GAGCAGGAGGAAGGGAAAGAAGG + Intronic
1178413378 21:32384089-32384111 CAGTAGCAGGCAGGACAAGAGGG + Intronic
1178940383 21:36900541-36900563 GAGCAACAGGGAGCCCCAGAAGG + Intronic
1179128246 21:38611462-38611484 GAGCAGCAGGGAGGTCAGGGCGG - Intronic
1179242047 21:39601361-39601383 GAGGAGCAAGCAGGCCAGGACGG + Intronic
1179292397 21:40030191-40030213 GAGGAGCAGGGAGGCTGAGAGGG - Intronic
1179674563 21:42973307-42973329 AAGCAGCAGGGTGGGCAAGAGGG - Intergenic
1179999874 21:44990783-44990805 GAGCTGCAGGAGGGCCAGGAGGG - Intergenic
1180768788 22:18364418-18364440 GAGAAGCAGAAAGGCCAGGAGGG - Intergenic
1180801149 22:18632529-18632551 GACCAGCAGGGATGCCATGAGGG + Intergenic
1180810246 22:18755287-18755309 GAGAAGCAGAAAGGCCAGGAGGG + Intergenic
1180852379 22:19028088-19028110 GACCAGCAGGGATGCCATGAGGG + Intergenic
1180949764 22:19715708-19715730 GTGCAGCAGGCAGGGCAGGAGGG + Intronic
1181213139 22:21303585-21303607 GAGAAGCAGAAAGGCCAGGAGGG - Intergenic
1181220571 22:21362732-21362754 GACCAGCAGGGATGCCATGAGGG - Intergenic
1181523786 22:23466575-23466597 GAGAAGCAGCAAGGCCAGGAGGG - Intergenic
1181688174 22:24543441-24543463 GGGCAGTAGGCAGGCCAGGATGG + Intronic
1181759879 22:25050986-25051008 GAGGAGCAGGACGGCCAAGGAGG - Intronic
1183730866 22:39617739-39617761 GGGCAGCAGCTAGGCAGAGAGGG - Intronic
1183943048 22:41307221-41307243 CAGCAGTAGGGAGGCCAAGGCGG - Intronic
1184973239 22:48042885-48042907 GAGCAGCTGCCAGGCCAAGGAGG + Intergenic
1185310495 22:50151631-50151653 GAGCAGCTGCTGGGCCCAGAGGG + Intronic
1203276806 22_KI270734v1_random:93552-93574 GAGAAGCAGAAAGGCCAGGAGGG - Intergenic
950046131 3:9949580-9949602 CTGCAGCATGAAGGCCAAGAGGG - Exonic
950433206 3:12963360-12963382 GAGCAGCTGGGACCCCAAGAAGG + Intronic
950625643 3:14244708-14244730 GAGCAGCAGGTGGGTCAGGGTGG + Intergenic
950666349 3:14497605-14497627 GAGCAGCAGGGAGCCCCTGAAGG + Intronic
951453391 3:22864405-22864427 AAGCAGCAGGGAGACCAATAAGG + Intergenic
952266042 3:31787345-31787367 TCGCAGCAGGGAGGCCAAGGCGG + Intronic
954301820 3:49704343-49704365 GACCAGCAGGAAGGGCATGATGG + Intronic
955617421 3:60823940-60823962 GAACAGCAGGGAGGCCAGTATGG + Intronic
956958741 3:74373309-74373331 GAGCAGCAGGAAGACCCTGAAGG - Intronic
958078215 3:88711779-88711801 GAGGAGCAGGTGGAGCAAGATGG + Intergenic
961434241 3:126905639-126905661 GAGCAGCGGGGTGGCCAGGATGG + Intronic
961659398 3:128460495-128460517 GAACAGCAAGAAGGCCAGGAAGG - Intergenic
962008189 3:131369142-131369164 GAGCAGAAGGTAGGACAAGCTGG + Intergenic
962684783 3:137836821-137836843 GAGCAGGAGGAAGACAAAGAGGG - Intergenic
963280292 3:143377894-143377916 AAGCAGCAGGAAGGCCAGCATGG - Intronic
964412086 3:156408217-156408239 GAGAAACAAGTAGGCCTAGAAGG - Intronic
966268904 3:178081481-178081503 GAAAAGCAGGTAGGCCAGGGTGG - Intergenic
966346480 3:178986402-178986424 CAGGACCAGGAAGGCCAAGAAGG + Intergenic
966730211 3:183144654-183144676 GCCCAGCTCGTAGGCCAAGAGGG + Intronic
966902892 3:184499846-184499868 GAGCACCAGGGAGACCAGGAAGG + Intronic
968082581 3:195856910-195856932 GGGCGGCTGGCAGGCCAAGAAGG + Intergenic
968673391 4:1864230-1864252 GAGCCGCAGCTAGGGCCAGAAGG - Intergenic
969146880 4:5131609-5131631 GAGCAGCAGGCAGGCAAGGATGG - Intronic
969376871 4:6768805-6768827 GAGGAGCAGGCAGGCCATGGGGG - Intergenic
969413691 4:7045213-7045235 GAGAGGCAGGTAGGCCAGGGAGG - Intronic
969470807 4:7388205-7388227 GAGCAGGAGCCAGGCCAACACGG - Intronic
969878201 4:10151587-10151609 GAGAAACAGGAAGCCCAAGAGGG - Intergenic
971388467 4:26162870-26162892 GAGCGGCAGGGAGACCAAGAAGG + Intergenic
973764706 4:54152481-54152503 GAGCATCAAGGAGGCCAGGATGG + Intronic
975961173 4:79907404-79907426 GGGAAGCAGGAAGACCAAGAAGG - Intronic
977860894 4:101958520-101958542 TAGCAGCAGATGGGCCAAGCTGG - Intronic
977920876 4:102641239-102641261 GAACTGAAGGAAGGCCAAGAAGG + Intronic
978159470 4:105528791-105528813 GAACAGCAAGTAGGCCAGTATGG + Intergenic
979073754 4:116243986-116244008 GAGCTGCAGGTTGGCAAAGATGG + Intergenic
981843904 4:149144847-149144869 GACCATCAGGGAGGCCAATATGG + Intergenic
982288922 4:153760473-153760495 GAGCAGCATAGGGGCCAAGATGG - Intergenic
982401694 4:154975088-154975110 GGGCAACAGCAAGGCCAAGATGG - Intergenic
983826818 4:172272590-172272612 GTGCAGTAGGTAGTCCAAAATGG + Intronic
985631635 5:1017157-1017179 GGGCAGCAGGGAGGCCACCAGGG - Intronic
990649377 5:57880927-57880949 CAGCAGCTGGGAGGCCAAGCTGG - Intergenic
991371544 5:65925499-65925521 GAGCAGCGGGCAGGCCTCGAGGG + Intergenic
991478274 5:67047368-67047390 GAGCAGCAGGCAGGCCAGCATGG - Intronic
992596347 5:78351328-78351350 GAGCAGGAGGCAGAGCAAGAAGG - Intergenic
992778518 5:80108136-80108158 AAGCAGCCAGTAGGGCAAGAGGG + Intergenic
993172351 5:84435187-84435209 GAGAGGTAGTTAGGCCAAGAAGG + Intergenic
993768859 5:91899077-91899099 GAGCAGCAGATGGGCCATTAAGG - Intergenic
994653198 5:102555856-102555878 GAGCAGGAGGAAGACAAAGAGGG + Intergenic
995160330 5:108972360-108972382 GAGCTGCAGGTAGGGACAGAGGG - Intronic
995816303 5:116172174-116172196 TAGCAGCTGGTAAGCCAATATGG - Intronic
996448739 5:123592301-123592323 GAGCAGGAGGTAGGTAGAGATGG + Intronic
997914404 5:137909974-137909996 CAGCATTAGGGAGGCCAAGATGG + Intronic
999232187 5:150068248-150068270 CAGCAGCAGCAAGGCCATGATGG + Exonic
999818783 5:155203358-155203380 GAGCACCAGGTAGGCTATAAAGG + Intergenic
1001570247 5:172726012-172726034 GAGCAGCAGGGAGGCCAGCATGG - Intergenic
1002806752 6:583867-583889 GAGCTGCAGGGAGGGCAAGATGG + Intronic
1003123000 6:3333487-3333509 GAGCAGCAGGGAGGCCAGTGTGG - Intronic
1004890237 6:20094345-20094367 GAGCTGAAGGTAGGCCTAGCAGG + Intergenic
1006085666 6:31593162-31593184 GAGCAGCAGGGAGGGTAAGTAGG - Intergenic
1006770226 6:36547091-36547113 GAGCAGGAGAAAGCCCAAGAAGG + Intronic
1008044225 6:46835329-46835351 GAGCAGCAGGTCTCCGAAGAAGG + Exonic
1012840826 6:104326937-104326959 GAGCAGCAGGGAGGCCAGTATGG - Intergenic
1014512660 6:122343460-122343482 GAGCATCAGGGAGGCCAGAAAGG + Intergenic
1014778150 6:125533897-125533919 AAGCAGCAGAGAAGCCAAGAAGG - Intergenic
1015311393 6:131770895-131770917 GACCAGCAAGGAGGCCAGGATGG + Intergenic
1015847345 6:137534722-137534744 GAGCAGCAGGAAGGGAGAGAGGG - Intergenic
1016019378 6:139219670-139219692 GAGCAGCTGGGAGGCTGAGACGG + Intergenic
1016936910 6:149454579-149454601 GAGCAGGAGCTGTGCCAAGAGGG + Intronic
1018906672 6:168079757-168079779 CAGCAGCTGGAAGGCCAGGAAGG + Intronic
1019001575 6:168757853-168757875 GAGCAGGAGGAAGAGCAAGAAGG - Intergenic
1020001889 7:4760976-4760998 GGGCAGCAGGTCGGACAAGTGGG - Intronic
1020143274 7:5624003-5624025 GAGCAGCAGCCAGGCCATGCAGG - Intronic
1020430598 7:8113011-8113033 CAGCAGCAGGAAGGACAACATGG - Intergenic
1021765281 7:23942842-23942864 GGGCAGCAGGTAGAGCAAGAGGG - Intergenic
1022594013 7:31694641-31694663 GAGCAGCAGGTAAACCATTATGG + Intronic
1024257375 7:47548878-47548900 GAGCAGCAGGGAGGACATGTTGG - Intronic
1024583217 7:50817803-50817825 GAACAGCACAGAGGCCAAGAGGG - Intergenic
1026991383 7:74587851-74587873 AAGCAGCAGATAGGCCGTGACGG + Intronic
1027262863 7:76477389-76477411 GAGAGGCAGGGAGGCCAAGATGG + Intronic
1027314245 7:76975498-76975520 GAGAGGCAGGGAGGCCAAGATGG + Intergenic
1028416165 7:90582862-90582884 CAGCATCAGGGAGGCCAAGGCGG - Intronic
1029369875 7:100142465-100142487 CAGCAGGTGGTAGGCCAAGGTGG + Intergenic
1032107766 7:129049051-129049073 GAGAAGCAGGTAAGCCTTGAAGG + Intronic
1033532576 7:142280057-142280079 GTGAAGCAAGTATGCCAAGAGGG + Intergenic
1035010953 7:155714587-155714609 AAGCAGCAGTTAGATCAAGAAGG + Intronic
1035317520 7:158006092-158006114 GGGCAGCAGGTGCCCCAAGAAGG - Intronic
1035331948 7:158102171-158102193 CAGCAGCAGGGCGGCCAGGAGGG + Intronic
1036773399 8:11593797-11593819 GTCCAGCAGCTAGGCCGAGAGGG - Intergenic
1038220586 8:25603364-25603386 GAGCAGCTCATAGGCCAAGGTGG + Intergenic
1040568645 8:48589133-48589155 CAGCCACAGGGAGGCCAAGAGGG - Intergenic
1042477595 8:69266575-69266597 CAGAAGCAGGAAGGCCAAGGAGG + Intergenic
1043550286 8:81363818-81363840 GGGAAGCAGGCAGGCCAAGTAGG + Intergenic
1044552960 8:93532567-93532589 GAACAGCAGGAAGGGCATGAGGG - Intergenic
1045245383 8:100437727-100437749 CAGCAGCAGCAAGGCCAGGAAGG + Intergenic
1045473575 8:102534836-102534858 GTGCATCAGGTAGGCCACAATGG - Intronic
1046029689 8:108768716-108768738 GAGCAGCAGGTAGGAGCTGATGG - Intronic
1046191939 8:110807380-110807402 GAGGAGAAGATAAGCCAAGATGG - Intergenic
1046904477 8:119557818-119557840 GAGTGGCAGGGAGGCCAGGAAGG - Intronic
1047203076 8:122782386-122782408 GCGCCGCAGTTTGGCCAAGAAGG - Intronic
1048083538 8:131154006-131154028 AGGCCGCAGGTAGCCCAAGATGG - Intergenic
1049184282 8:141241231-141241253 GAGCAGCAGCACAGCCAAGAAGG + Intronic
1049709811 8:144058413-144058435 GGGCAGCAGGCGGGCCATGAGGG + Intronic
1049772798 8:144391532-144391554 GAGCAGCTGGTAGGCAGAGCTGG + Intronic
1051260424 9:15258550-15258572 GAGCAGCAGCCATGTCAAGAAGG + Intronic
1051734402 9:20183764-20183786 GAGCTAGAGGTAGGCCTAGAGGG + Intergenic
1052825624 9:33172134-33172156 GTACTGCAGGTAGGCCAACAAGG + Intergenic
1053079910 9:35166967-35166989 GAGCTGCATGTGGCCCAAGACGG + Intronic
1053653373 9:40191662-40191684 GAGCAGCAGGTCTCCAAAGAAGG - Intergenic
1054531211 9:66184556-66184578 GAGCAGCAGGTCTCCAAAGAAGG + Intergenic
1055203403 9:73695832-73695854 GAGCAGCAGCAAGAGCAAGAGGG - Intergenic
1056099901 9:83291380-83291402 CTGCAGCAGGTAGGGCAAGCGGG - Intronic
1056293526 9:85168440-85168462 GAGCAGCAAGTTAGCTAAGAAGG + Intergenic
1056570851 9:87813518-87813540 GAGCAGCTGAAAGGCCCAGAGGG - Intergenic
1057225398 9:93290268-93290290 GAGCTGCATGTGGCCCAAGACGG + Intronic
1057806467 9:98223251-98223273 GAGCAGCAGGTGGGAGATGAGGG + Intronic
1058812751 9:108657065-108657087 GAGCAGCAGGAATTCCAAAAAGG + Intergenic
1059448910 9:114357806-114357828 GAGCAGCAAGTATTCCAAGAAGG + Intronic
1059668774 9:116474216-116474238 GAGCAGCAGGTAGGCTATAACGG + Intronic
1059932823 9:119278253-119278275 GAGAGGCAGGGAGGCGAAGAGGG - Intronic
1060560712 9:124540373-124540395 GAGCAGGAGGAAGGCCACGAAGG - Intronic
1060723893 9:125995116-125995138 GACCAGCAGGTTGGCCTAGGTGG - Intergenic
1061297721 9:129686097-129686119 GAGCATAAGGAAGGCCAGGATGG + Intronic
1061393069 9:130328278-130328300 GAGCTGCAGCAATGCCAAGAGGG - Intronic
1061498276 9:130988013-130988035 GAGCAGAAGGGAGGGCAAGAGGG + Intergenic
1061613784 9:131765935-131765957 GAGCAGGAGGTCGGCCCAGCAGG - Intergenic
1061976455 9:134070319-134070341 GAGCAGCGGGAAGGGAAAGAAGG - Intergenic
1062655400 9:137602090-137602112 GAGCAGCAGGGATGCAAAGGTGG + Intergenic
1062660980 9:137632952-137632974 CAGCAGCAGGAAGACCAGGAAGG - Intronic
1187087468 X:16056161-16056183 ATGGAACAGGTAGGCCAAGAAGG - Intergenic
1188352571 X:29150465-29150487 GAGTAGAAAGAAGGCCAAGATGG + Intronic
1188545235 X:31298284-31298306 AAGCAGCTGGTAGGTCAATATGG + Intronic
1189670473 X:43402996-43403018 GGGCAGAAGGTAGGGGAAGATGG + Intergenic
1190214250 X:48469321-48469343 GAGGAGCAGGTAGGTGAGGAGGG - Exonic
1190813756 X:53909710-53909732 GAACAGCAAGGAGGCCAATATGG + Intergenic
1191976985 X:66883871-66883893 GAACAGCAAGTAGGCCAATGTGG - Intergenic
1193594115 X:83424294-83424316 GAGCAACAGAAAGGCCGAGAAGG - Intergenic
1194355986 X:92884567-92884589 CAGCACTAGGGAGGCCAAGATGG - Intergenic
1195746556 X:108124211-108124233 CAGCAGCAGAGAGGCTAAGATGG + Intronic
1195770703 X:108347955-108347977 AAGCAGCAGGCAGGCCAGGCTGG + Intronic
1195927527 X:110040721-110040743 AAGCAGCAGGTAACCCCAGAGGG - Intronic
1198278238 X:135117654-135117676 GGGCAGCAGGTAGGGCAAGAAGG - Intergenic
1198292724 X:135254862-135254884 GGGCAGCAGGTAGGGCAAGAAGG + Intronic
1198300743 X:135332117-135332139 GAGCAGCAGGTAGGCCAAGAAGG + Intronic
1198307896 X:135400622-135400644 AAGCAGCAGGTAGGGCAAGAAGG + Intergenic
1199692627 X:150320299-150320321 GGGCACCAGGTAGGGCAGGAAGG + Intergenic
1200108620 X:153727568-153727590 AAGTAGCACGTTGGCCAAGAGGG + Intronic
1200664332 Y:6001544-6001566 CAGCACTAGGGAGGCCAAGATGG - Intergenic
1201767832 Y:17589198-17589220 GCCTAGCAGGTAGGCCATGAGGG + Intergenic
1201833721 Y:18316787-18316809 GCCTAGCAGGTAGGCCATGAGGG - Intergenic