ID: 1198301363

View in Genome Browser
Species Human (GRCh38)
Location X:135336775-135336797
Sequence CTGGGAATAAGGAGAGGGGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 842
Summary {0: 1, 1: 1, 2: 12, 3: 88, 4: 740}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1198301363_1198301374 8 Left 1198301363 X:135336775-135336797 CCTTCCCCTCTCCTTATTCCCAG 0: 1
1: 1
2: 12
3: 88
4: 740
Right 1198301374 X:135336806-135336828 ACCACAGGAGCCTTTGTTCGGGG 0: 1
1: 0
2: 1
3: 5
4: 90
1198301363_1198301372 6 Left 1198301363 X:135336775-135336797 CCTTCCCCTCTCCTTATTCCCAG 0: 1
1: 1
2: 12
3: 88
4: 740
Right 1198301372 X:135336804-135336826 AAACCACAGGAGCCTTTGTTCGG 0: 1
1: 0
2: 1
3: 12
4: 141
1198301363_1198301369 -7 Left 1198301363 X:135336775-135336797 CCTTCCCCTCTCCTTATTCCCAG 0: 1
1: 1
2: 12
3: 88
4: 740
Right 1198301369 X:135336791-135336813 TTCCCAGGTTTGTAAACCACAGG 0: 1
1: 0
2: 2
3: 18
4: 173
1198301363_1198301373 7 Left 1198301363 X:135336775-135336797 CCTTCCCCTCTCCTTATTCCCAG 0: 1
1: 1
2: 12
3: 88
4: 740
Right 1198301373 X:135336805-135336827 AACCACAGGAGCCTTTGTTCGGG 0: 1
1: 0
2: 0
3: 7
4: 129

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1198301363 Original CRISPR CTGGGAATAAGGAGAGGGGA AGG (reversed) Intronic
900573124 1:3369524-3369546 CTGGGTATGAGGAGAAAGGATGG + Intronic
900618681 1:3577133-3577155 CTCGGAAGAAGGGGAGGGTATGG - Intronic
901266390 1:7914079-7914101 CTGGGATTGAGGAGAGGGGAAGG - Intergenic
901422797 1:9162328-9162350 AAGGGAAGAAGAAGAGGGGAGGG + Intergenic
901672742 1:10865888-10865910 CTGGGAATGGGGAGAGAAGAAGG + Intergenic
902535812 1:17118869-17118891 GTGGGAAGCAGGAGAGGGGCTGG + Intronic
902779193 1:18693582-18693604 CTGGGAGTGAGGACAGGGGGCGG - Intronic
902784695 1:18725407-18725429 GCGGGAGGAAGGAGAGGGGAGGG - Intronic
903069947 1:20722145-20722167 CTGGGAAGAGAGAGAGGGAATGG - Intronic
903176706 1:21585851-21585873 CTGTGGAAATGGAGAGGGGAGGG + Intergenic
903549883 1:24150566-24150588 CAGGGAACCTGGAGAGGGGAGGG - Intergenic
904603351 1:31685573-31685595 GCGGGGCTAAGGAGAGGGGAGGG - Intronic
904911355 1:33936674-33936696 CTGGCAATAAGGAGGGAGGGAGG + Intronic
905015034 1:34772074-34772096 CTGGAAATAAGTAGTGGTGATGG - Intronic
905183025 1:36178202-36178224 GTAGGAATGAAGAGAGGGGAGGG + Intronic
905359895 1:37412008-37412030 CTGGGACATAGGAAAGGGGAGGG - Intergenic
905400218 1:37696338-37696360 CTGGGAGGAAGGAGATGAGAGGG - Intronic
905869570 1:41395353-41395375 CTGGGAGTGAGGAGCGGGGAGGG - Intergenic
906197856 1:43940150-43940172 CTGGGGATAGGGAAAGGGGATGG - Intergenic
906640177 1:47436998-47437020 CTGGGGCCAGGGAGAGGGGAGGG + Exonic
906681963 1:47733232-47733254 GTGGGAGTCAGGAGAGAGGATGG - Intergenic
906700626 1:47855316-47855338 CTGGGATTAAGGAGAGGAAAGGG - Intronic
906720705 1:48002129-48002151 CAGGGAATAGGAAGAAGGGAAGG + Intergenic
906775983 1:48530015-48530037 TGGGGGATAGGGAGAGGGGAAGG - Intergenic
907049374 1:51319324-51319346 ATGGGAAAAAGGAGAGGGAGAGG + Intronic
907303765 1:53502910-53502932 CAGGGAGACAGGAGAGGGGAGGG + Intergenic
907308204 1:53525282-53525304 ATGGGGAGGAGGAGAGGGGAAGG + Intronic
907425359 1:54375924-54375946 CTGGGAGGAAAGGGAGGGGAAGG + Intronic
907695312 1:56720760-56720782 CTGGGGATAGGGTGCGGGGAGGG - Intronic
907731421 1:57070325-57070347 TTGGGAATAAGCACAGGGGAGGG + Intronic
907926142 1:58956802-58956824 CTGGGTATAGGGAGAAAGGAAGG - Intergenic
908786362 1:67738481-67738503 CTGGAGATAAACAGAGGGGAGGG - Intronic
908906199 1:69013511-69013533 CTGGGAATCAGGGGAGCTGATGG - Intergenic
908906437 1:69017295-69017317 TTGGGAATAAGGAGAAGAGAAGG - Intergenic
908951479 1:69567850-69567872 GTGGGAAAAAAGAGAGGGGGCGG + Intergenic
909792078 1:79692658-79692680 CTGGGACTATGGAGATGGAATGG - Intergenic
910461108 1:87448801-87448823 CTGCCAAGAAGGTGAGGGGAAGG + Intergenic
910991493 1:93061278-93061300 CAGTGAATAAGGAGAAGGCAGGG - Intergenic
911498130 1:98655240-98655262 CTGGAACTAAGAAGAGGGAAGGG + Intergenic
911538150 1:99125230-99125252 GTGGGAAGAGGGAGAGAGGAAGG - Intergenic
912306072 1:108568806-108568828 CTGGGAAGGAGGAGAGGGGAAGG + Intronic
912380651 1:109246443-109246465 CTGGGAAGGAGGGGTGGGGAGGG - Intergenic
912386142 1:109272201-109272223 CTGGGAAGAAGGAGGGTGGAGGG - Intronic
913130774 1:115837490-115837512 CTGGGAAGGAGGAGAGAGGAGGG - Exonic
914196815 1:145451977-145451999 GGGGGAAGAAGGGGAGGGGAAGG + Intergenic
914407468 1:147390036-147390058 AGGGGAAGAGGGAGAGGGGAGGG - Intergenic
915157671 1:153891622-153891644 GAAGGAAAAAGGAGAGGGGAAGG + Intronic
915897360 1:159822670-159822692 CTGGGGATAAGTAGAGGGAGTGG - Intergenic
916377603 1:164172601-164172623 CTGGGAATAGGAAGAGAGAAAGG + Intergenic
916746081 1:167685863-167685885 CTTGGAATAAGGTGTGGAGAAGG + Intronic
916989445 1:170226612-170226634 ATGGAAAGAAGGAGAGAGGAAGG - Intergenic
917231984 1:172847157-172847179 CTGTGAAGAAGGAAAGGAGAGGG + Intergenic
917256174 1:173118709-173118731 CAGGGAAAAGGGAGAGGGGAAGG + Intergenic
917632522 1:176904244-176904266 CTGGGAGGAAGCTGAGGGGATGG - Intronic
917687364 1:177431054-177431076 CTTGAAGTAAGGAGAGAGGATGG + Intergenic
917867208 1:179208306-179208328 CTGGGAACTATTAGAGGGGAAGG - Intronic
918157303 1:181861106-181861128 TTGTGAATAAGAAAAGGGGAAGG + Intergenic
918416775 1:184317459-184317481 AAGGGAGAAAGGAGAGGGGAGGG + Intergenic
919758039 1:201078140-201078162 CTGGGAGTCAGGAGAAGGGAAGG - Intronic
919966385 1:202530749-202530771 CTGGGAGTAGGGAGAAGAGATGG - Intronic
920034471 1:203056891-203056913 TTGGGAAGAAGGAGAAGGGCAGG + Exonic
920109055 1:203574363-203574385 CTGGGAAGATGGAGATGGGCAGG - Intergenic
920420510 1:205830111-205830133 CTGGCAATAAGGACAGTAGATGG + Intronic
920869274 1:209780375-209780397 CTAGGAGTGGGGAGAGGGGAGGG - Exonic
921604204 1:217136677-217136699 CTGGCCAAAAGGAAAGGGGAAGG - Intronic
921858404 1:220014389-220014411 CTGGTTATATGGAGTGGGGAGGG - Intronic
922698838 1:227746167-227746189 CTGGAAGTCATGAGAGGGGAAGG - Intronic
922955192 1:229593836-229593858 GCGGGAATGAGGAAAGGGGAGGG - Exonic
923300423 1:232635349-232635371 TTGGAAGGAAGGAGAGGGGAAGG + Intergenic
923523764 1:234756873-234756895 GTGAGACCAAGGAGAGGGGAAGG + Intergenic
923772925 1:236953155-236953177 CTGTGAACAAGGACAGAGGATGG - Intergenic
924617301 1:245622808-245622830 CTGGGATTGAGGCGGGGGGAAGG + Intronic
1063529761 10:6819692-6819714 CTGGGGCTGAGGAGAGGAGAAGG + Intergenic
1063661730 10:8038833-8038855 CGGGGAAAAGGGAGAGGGAAGGG + Intergenic
1064339307 10:14472433-14472455 ATGGCAATGAGGAGAAGGGAAGG - Intergenic
1064438805 10:15334356-15334378 CTGGGAATCAGGAGATCTGAGGG + Intronic
1064504016 10:16009857-16009879 TTAGGAAGAAGGAGAGAGGATGG + Intergenic
1065806041 10:29394591-29394613 CTGGGAGCAAGGAGAGGCCAGGG - Intergenic
1066045527 10:31592217-31592239 GAGGGAAGGAGGAGAGGGGAAGG - Intergenic
1066280177 10:33909541-33909563 CTGGGAACTACTAGAGGGGAGGG - Intergenic
1066332954 10:34444841-34444863 GTGGGAATAAGCAGAAGGAATGG - Intronic
1066681901 10:37942759-37942781 CTGGGAACAAGGAGTGGTGGCGG - Intergenic
1067528836 10:47055736-47055758 CAGGGAAGAAGGAGGAGGGAGGG + Intergenic
1067665240 10:48271958-48271980 CTGAGTATATGGAGAGGGCAGGG + Intronic
1067696930 10:48542537-48542559 CTGGGAATCAGGAGGCAGGAGGG - Intronic
1067894075 10:50161013-50161035 GTGGGAGTAAGAAGAGGAGATGG - Intergenic
1067954772 10:50779251-50779273 GTGGGAGTAAGAAGAGGAGATGG + Intronic
1069293629 10:66815314-66815336 CTGGGGATGAAGGGAGGGGATGG - Intronic
1069876736 10:71567747-71567769 CTGGGAGCAAGGAGAGGGGGCGG - Intronic
1070126533 10:73626413-73626435 AAGGGAATGAGGAGATGGGAAGG - Intergenic
1070219199 10:74422907-74422929 CTGGGAGTTAGGAGTGGGGAGGG + Intronic
1070442399 10:76459608-76459630 GTGGGAATAGGGAGAGGAAATGG + Intronic
1070642413 10:78179318-78179340 CTGGGGAGAAGGAGGGGAGAAGG + Intergenic
1071293873 10:84205413-84205435 GAGGGAATAAAGAGAGGAGAGGG - Intronic
1072044125 10:91637671-91637693 GTGAGGAAAAGGAGAGGGGAGGG + Intergenic
1072066284 10:91874714-91874736 CTGGGAAAAAGGAGTAGGTAGGG - Intergenic
1072165807 10:92812056-92812078 GTGGGAATCAGGAAAGGGAAAGG + Intergenic
1072652647 10:97307657-97307679 GTGGGAAGAAGGAGAGTGGGAGG + Intergenic
1072728318 10:97828377-97828399 CTGGGACTATTGGGAGGGGAGGG - Intergenic
1073071711 10:100798578-100798600 ATAGGAAAAAGGAGAGAGGAGGG - Intronic
1073328844 10:102657900-102657922 CTGGGAAGATGGTGAGGAGAAGG - Exonic
1073345147 10:102777244-102777266 CTGGCCATAAGGGGTGGGGAGGG + Intronic
1073987928 10:109230313-109230335 ATGGGAATCAGGAAAAGGGAAGG - Intergenic
1074202297 10:111248682-111248704 CTAGGAGTCAGGATAGGGGAGGG - Intergenic
1074522008 10:114234485-114234507 CTGGGAATTTGGAGAGGAGATGG + Intergenic
1074969683 10:118525871-118525893 AAGGGAAGAAGGAGAGGGAAAGG + Intergenic
1075051283 10:119184064-119184086 GTGGGCATAAGGAGAAGAGAAGG - Intergenic
1075084080 10:119402433-119402455 CAGGTATTCAGGAGAGGGGAGGG + Intronic
1075481604 10:122787128-122787150 CTGGGAATAAGGAGTCAGGTGGG + Intergenic
1076182930 10:128424703-128424725 CTAGGAAAGAGGAAAGGGGATGG - Intergenic
1076333237 10:129687046-129687068 CAGCGACTAAGGAGATGGGAGGG - Intronic
1076335357 10:129702964-129702986 CAGGGAAGGAGGAGAGGGCAGGG + Intronic
1076394451 10:130128856-130128878 CTTGGGCTAAGGAGAAGGGACGG + Intergenic
1076671914 10:132126178-132126200 CTGGGAATTAGGACAGGAGGTGG - Intronic
1076715595 10:132362333-132362355 CTGGGACCAACGTGAGGGGAAGG + Intronic
1076827295 10:132975454-132975476 CTGAGGATAAGGAGGGGGTAAGG - Intergenic
1076946871 10:133657475-133657497 CAGGGACTAAGGAGAGGGGGTGG + Intergenic
1077092362 11:785035-785057 CCGGGGTTAAGGGGAGGGGACGG + Intergenic
1077287734 11:1775295-1775317 CAGATACTAAGGAGAGGGGATGG + Intergenic
1077595341 11:3527046-3527068 CTGGGGGAAAGGGGAGGGGATGG - Intergenic
1077670911 11:4156827-4156849 TTGGGAATGAGGAGAGGAGAGGG - Intergenic
1077986019 11:7351824-7351846 CTGAGAGTAAGGAGAAAGGAAGG + Intronic
1078462996 11:11529486-11529508 CCGAGAATAAGGAGAGCAGATGG - Intronic
1078599157 11:12715389-12715411 CTGGGGAGGAGGAGAGGGTATGG + Intronic
1078605440 11:12771085-12771107 TTGGGGAAAAGGAGAAGGGAAGG + Intronic
1079339219 11:19598140-19598162 TTGGGAGCAGGGAGAGGGGAGGG + Intronic
1080061803 11:27964365-27964387 CAGGGCATGTGGAGAGGGGAAGG - Intergenic
1080340107 11:31252527-31252549 CTGGAAAAAAAGAGAGGGTAGGG + Intronic
1080368841 11:31610511-31610533 TGGGGAATACGGAGGGGGGAAGG - Intronic
1081704358 11:45172319-45172341 CTGGCAACAAGAAGAGGGGCTGG - Intronic
1081932554 11:46882155-46882177 ATGGGAATAAAGAAAGAGGAGGG + Intronic
1081965154 11:47164936-47164958 CTGGGTGCCAGGAGAGGGGAAGG - Exonic
1082001939 11:47398050-47398072 CTGAGAATAGGGACAGGGTAGGG - Intergenic
1082776555 11:57249350-57249372 CCTGGAATAAGGAGAGAGGTTGG - Intergenic
1082835709 11:57648977-57648999 CTGGGAATTAGGGGAGAGGGAGG - Exonic
1082909488 11:58354126-58354148 CTGGGAAAAAAGAAATGGGAAGG - Intergenic
1083304755 11:61756498-61756520 CAGGGAGTAAGTAGATGGGAGGG + Intronic
1083832743 11:65243330-65243352 CTGGGATTACAGAGAGGAGAAGG + Intergenic
1084150655 11:67286452-67286474 CGGGGAATGAGTAGACGGGAGGG - Exonic
1084421849 11:69064279-69064301 CGGGGGATAGGGAGGGGGGAGGG - Intronic
1084604098 11:70162450-70162472 GTGGGGACAAGGAGAGAGGAGGG + Intronic
1084608675 11:70187059-70187081 CTGGGAAGAGGGAGATGGGATGG + Intronic
1084821603 11:71695013-71695035 CTGGGGGAAAGGGGAGGGGATGG + Intergenic
1085118218 11:73949249-73949271 AGGTGAATGAGGAGAGGGGATGG + Intergenic
1085256231 11:75175120-75175142 CTGGGGATGGGGAGTGGGGAGGG + Intronic
1085284335 11:75350347-75350369 ATGGAAACGAGGAGAGGGGAGGG + Intronic
1085305444 11:75483067-75483089 CTGGCAGGAAGGGGAGGGGAGGG - Intronic
1085533447 11:77204737-77204759 CTGGGTGTAAGGAGAGAGGGTGG - Intronic
1086186738 11:84026688-84026710 CTGGGAATATGGAGTGGGGAAGG - Intronic
1086239512 11:84672680-84672702 CAGGGAAGAATGAGAGGGAAAGG - Intronic
1086306423 11:85485562-85485584 ATGTGAGTAAGGAGAGGGAAGGG + Intronic
1086598168 11:88600175-88600197 ATGGGAGGAAGGAGATGGGAAGG - Intronic
1086662873 11:89443323-89443345 AGGGGAAAAAGGAGTGGGGAAGG + Intronic
1087076458 11:94130572-94130594 CTGGGAAGAAGGTGAGAGGATGG + Intronic
1087279528 11:96194747-96194769 CTGAGAATAAAGAAAGGGAAAGG - Intronic
1088335957 11:108704117-108704139 CTGGGAATGAGTAGATGAGATGG + Intronic
1088617196 11:111642673-111642695 CTGGGAATCTAGAGAGGGGATGG - Intronic
1088756062 11:112886398-112886420 CAGGTGATAAGGGGAGGGGACGG - Intergenic
1088970891 11:114773860-114773882 CTGAGAATCAGGAGAGTGAATGG - Intergenic
1089282631 11:117385115-117385137 CAGGGAAGAAAGAGAGCGGAGGG - Intronic
1089432524 11:118436176-118436198 CTCGGGAAAAGGAGGGGGGAAGG - Intergenic
1089524881 11:119090348-119090370 CTGGGAGTCCGGAGAGTGGAAGG + Intronic
1089570939 11:119409110-119409132 GTGGGAATATGGAGAGGAGGCGG - Intergenic
1089727885 11:120498799-120498821 CAGGGACTGGGGAGAGGGGAGGG + Intergenic
1090226718 11:125076192-125076214 CTGGGACTAAGAAGAGGGCTGGG + Intronic
1090285262 11:125494903-125494925 ATGGGAAGAAGGAGATGGAATGG - Intronic
1090429269 11:126632609-126632631 CTGAGAGTAGAGAGAGGGGAAGG - Intronic
1090434359 11:126674547-126674569 CTTGGAATTAGGAAAGGAGATGG - Intronic
1091138030 11:133210396-133210418 CTGGGAAGAGGGAGAGAGAAGGG - Intronic
1091201098 11:133781871-133781893 CTGAGAATAAGGTGAGGAGGAGG - Intergenic
1091320790 11:134647886-134647908 GATGGAATTAGGAGAGGGGAGGG - Intergenic
1091555344 12:1569306-1569328 CTGGTGAAAAGGAGAGGGAATGG - Intronic
1091600055 12:1912568-1912590 ATGAGAAGGAGGAGAGGGGAGGG + Intronic
1091754969 12:3045366-3045388 CTGGGTGTCAGGAAAGGGGAGGG + Intergenic
1092203759 12:6603361-6603383 TTGGGAAGAGGGAGAGAGGAGGG - Intronic
1092208578 12:6631831-6631853 CTGGGAACAATGAGAAGGGCAGG + Intronic
1092246421 12:6866847-6866869 GTGTGAATAAAGAGAGGGAAGGG - Intergenic
1092421498 12:8335820-8335842 CTGGGGGAAAGGGGAGGGGATGG - Intergenic
1092737628 12:11598239-11598261 ATGGAAAGAAGGAGAGGGAAGGG + Intergenic
1092926294 12:13275483-13275505 CGGAGAAGGAGGAGAGGGGATGG - Intergenic
1093121113 12:15272864-15272886 CTGGGGACATGGAGTGGGGAAGG - Intronic
1093711367 12:22333797-22333819 CTGGGGATCAGGGGTGGGGAAGG + Intronic
1094177118 12:27552495-27552517 GTGGGACTAAGGAGAAGGCAGGG + Intronic
1095315768 12:40759430-40759452 AAGGGAAGAAGGGGAGGGGAGGG - Intronic
1095820901 12:46477514-46477536 CTGTGAATGAAGAGAGGGTAGGG - Intergenic
1095983206 12:47984276-47984298 CTGGGAAGGAAGGGAGGGGAAGG - Intronic
1096138243 12:49220651-49220673 ATGGGAAAAAGAAGAGGGGAAGG + Intronic
1096481853 12:51947332-51947354 CGGGAAATGAGGAAAGGGGATGG - Intergenic
1096693024 12:53332850-53332872 CTGGGCAGAGGGAGAGGGGGCGG - Intronic
1096805937 12:54141145-54141167 TGGGGAATGTGGAGAGGGGAGGG - Intergenic
1096813396 12:54185914-54185936 GTGGGAGGAAGGAGAAGGGAGGG + Intronic
1097068351 12:56337108-56337130 AATGGAATAAGGAAAGGGGAGGG - Intronic
1097326710 12:58285394-58285416 CTGGGAATAAGAATGGAGGAAGG + Intergenic
1097907651 12:64936887-64936909 TTTGGAAGAAGGGGAGGGGAGGG - Intergenic
1098275335 12:68806984-68807006 CTGGGAAGCGGGAGAAGGGAAGG + Intergenic
1098529106 12:71520391-71520413 CTGGAAATAAGGGGAATGGAGGG + Intronic
1100563130 12:95769074-95769096 CAGGGAAGAAAGAGAGCGGAAGG + Intronic
1101017803 12:100519766-100519788 CTGGGGATAGGGAGTTGGGAGGG + Intronic
1101042569 12:100771617-100771639 CTAGGAGAAGGGAGAGGGGAAGG + Intronic
1101718955 12:107334622-107334644 CTCGGATTCAGGAGAGAGGATGG + Intronic
1101937745 12:109071827-109071849 GTGGGAATGAGGCCAGGGGAGGG + Intronic
1102133439 12:110552452-110552474 CAGGGTAGAAGGAGAGGGGATGG - Intronic
1102475559 12:113185959-113185981 GTGGGAAGAAGGTGCGGGGACGG + Exonic
1102749180 12:115277268-115277290 CGGGGGAGAAGGAGAGGGGGAGG + Intergenic
1102806099 12:115782290-115782312 CTGGGACTTGGGAGAAGGGAGGG + Intergenic
1102826265 12:115950169-115950191 CTGGGTAAGAGGTGAGGGGAAGG + Intergenic
1102840388 12:116113787-116113809 GGGGGAAGAGGGAGAGGGGAGGG + Intronic
1102840400 12:116113812-116113834 GGGGGAAGAGGGAGAGGGGAGGG + Intronic
1103213460 12:119183410-119183432 CTGGGACTAAGGAGAAGGGGTGG - Intronic
1103721869 12:122979549-122979571 CAGGGAAGCAGGGGAGGGGAGGG + Exonic
1103833733 12:123801908-123801930 CAGGGATTAAGGAGAGGGCAAGG - Intronic
1103955826 12:124576292-124576314 CTGGGAAGAAGGGAAGGGGCAGG - Intergenic
1104198045 12:126560400-126560422 AGGGGAAGAGGGAGAGGGGATGG - Intergenic
1104757662 12:131279158-131279180 GTGGGGAGAGGGAGAGGGGAAGG + Intergenic
1104789186 12:131471306-131471328 CTGGGAACATCTAGAGGGGAGGG + Intergenic
1106160184 13:27194513-27194535 CTTGGAAAAAGGAGATGAGATGG - Intergenic
1106192997 13:27470450-27470472 CTAGGGTTAAGGAGAAGGGAGGG + Intergenic
1106935511 13:34714333-34714355 CTGGCAATGAGCAGAGGGCATGG - Intergenic
1107414916 13:40191574-40191596 GTTGGAAGAAGGGGAGGGGAGGG - Intergenic
1107658286 13:42613905-42613927 CTGGGAACTAGGAGAGCTGATGG + Intergenic
1108104753 13:46997270-46997292 ATGGAAATAGGGAGTGGGGATGG - Intergenic
1108313537 13:49218029-49218051 TTGGGTCTAAGGAGAGAGGAGGG + Intergenic
1108443209 13:50477527-50477549 ATGGAAATGAGGAAAGGGGAAGG + Intronic
1108959884 13:56213489-56213511 CTGAGAAAAAGGAGAGTTGATGG - Intergenic
1109257300 13:60098479-60098501 CTGGTAAAAAGGAGCTGGGAGGG + Intronic
1111196703 13:84883888-84883910 CTGGGAATAGGGAGCAGGGCAGG + Intergenic
1111549253 13:89785008-89785030 ATGGGAATAAAGACAAGGGAGGG - Intergenic
1112435401 13:99388441-99388463 CCAGGAATTAGGAGAGAGGAGGG + Intergenic
1112833117 13:103478084-103478106 ATGGGAGGAAGGAGAGAGGAAGG + Intergenic
1113474376 13:110569772-110569794 CAGGGAAAAGGGAGAGGGGGTGG + Intergenic
1113808674 13:113124229-113124251 CTGGGAAGAAGCAGAGGGTGGGG + Intronic
1114492273 14:23110661-23110683 ATGGGGATAAGGAGAGAGGATGG + Intergenic
1114570660 14:23665227-23665249 CTGGGAATAGGGGGAGAAGAAGG - Intergenic
1116403061 14:44532845-44532867 CTGGGAATAAAAAGGGGGAAAGG + Intergenic
1117693818 14:58338565-58338587 TAGGGATGAAGGAGAGGGGATGG + Intronic
1118749409 14:68795397-68795419 CTGGAAAAAAGCAAAGGGGAAGG + Intronic
1118758526 14:68863326-68863348 CTGGGAAGAAGCAGGGGGGAAGG + Intergenic
1119481905 14:74963253-74963275 CTGTGAAAAGGGAGAGGAGATGG + Intergenic
1120774291 14:88415992-88416014 ATGGCAAGAACGAGAGGGGAAGG - Intronic
1121023634 14:90598460-90598482 ATGGGGGTAAGGAGGGGGGAAGG + Intronic
1121046313 14:90790864-90790886 CTGGCAAAAAGCAGAGGGAAGGG + Intronic
1121185882 14:91968840-91968862 CAGGGATTAAGGAGAGGGCCAGG + Exonic
1121277323 14:92677240-92677262 GTGGGAAGGAGGAAAGGGGAAGG - Intronic
1121299644 14:92860358-92860380 CGGCGGAAAAGGAGAGGGGAAGG + Intergenic
1122273739 14:100580560-100580582 CTGGGAATTAGATGATGGGAAGG - Intronic
1122636518 14:103132168-103132190 CTGGGAGTCAGGCGCGGGGATGG - Intronic
1122648103 14:103208051-103208073 CTGGAAATCAGGAAAAGGGATGG - Intergenic
1122704189 14:103609751-103609773 CTGGAAATGAGGAGAGGGGAGGG + Intronic
1122751535 14:103937463-103937485 CTGGGAAAGAAGGGAGGGGAGGG - Intronic
1123068118 14:105628274-105628296 CAGGCAAACAGGAGAGGGGAGGG - Intergenic
1123071835 14:105645884-105645906 CTGGGGCTGAGCAGAGGGGATGG - Intergenic
1123072659 14:105649258-105649280 CTGGGGCTGAGCAGAGGGGATGG + Intergenic
1123091499 14:105744160-105744182 CTGGGGCTGAGCAGAGGGGATGG - Intergenic
1123097267 14:105772501-105772523 CTGGGGCTGAGCAGAGGGGATGG - Intergenic
1202920946 14_KI270723v1_random:30030-30052 CAGGGACTAAGGAGAGGGGGTGG + Intergenic
1202923971 14_KI270724v1_random:7551-7573 CAGGGACTAAGGAGAGAGGGTGG - Intergenic
1123804104 15:23853853-23853875 CTGGTGATAAGGAGAAGGAAGGG + Intergenic
1123941701 15:25219721-25219743 TTGGGAACAAGCAAAGGGGAGGG + Intergenic
1126167604 15:45666929-45666951 ATGGGAGAAAGGAGAGGAGAGGG - Intronic
1126477335 15:49079562-49079584 CTGGGAGTGAGGGGTGGGGAGGG + Intergenic
1126668574 15:51095264-51095286 CGGGGAATAAGGGAAGGGGGCGG + Intronic
1126947243 15:53835348-53835370 CTAGGAAGATGGAGAGAGGAAGG + Intergenic
1127422091 15:58816207-58816229 CTGGGATTCAGGAGAATGGAAGG + Intronic
1127873145 15:63089809-63089831 CTGGGAATGAGGTGAGGGGTGGG + Intergenic
1128082045 15:64862466-64862488 CAGGGAATTTGGAGAGGGTATGG + Intronic
1128253880 15:66183179-66183201 GCGGGAGTGAGGAGAGGGGAAGG + Intronic
1128256389 15:66200553-66200575 CTGGAACTAAGGCGGGGGGAGGG - Intronic
1128375873 15:67075428-67075450 CTGGGGAGCAGGAGAGGGGGAGG + Intronic
1128539755 15:68518417-68518439 CAGGGAATGAGGACAGGGGAGGG - Intergenic
1128721731 15:69955297-69955319 GTGGGAGTAGGGAGAGGAGAAGG - Intergenic
1129806524 15:78464930-78464952 CTGGAACTAGGGAAAGGGGAAGG + Intronic
1130916883 15:88312160-88312182 CTGGGATTAAAGTGAGGGTATGG + Intergenic
1130923691 15:88369371-88369393 ATGTTAATCAGGAGAGGGGAGGG - Intergenic
1131071984 15:89471723-89471745 CTGGGATGAAGGGGAGGGCAGGG + Exonic
1131672079 15:94630873-94630895 CTGGGTAAAGGGAGAGGAGAGGG + Intergenic
1131701458 15:94941365-94941387 ATGGGAACCAGGAGAGGTGATGG + Intergenic
1132794821 16:1714640-1714662 CTGGGGAGAAGGAAAGGTGATGG - Intronic
1132852345 16:2030430-2030452 CTGGGAGCAAGGGCAGGGGAAGG - Intronic
1133038165 16:3046213-3046235 CTGGGGGGAAGGAGAGGGGCGGG + Intergenic
1133376785 16:5293745-5293767 CTGGGGGAAAGGGGAGGGGATGG + Intergenic
1133416776 16:5613040-5613062 ATGGGACTAAGGCTAGGGGAGGG + Intergenic
1133447496 16:5874646-5874668 CTGAGAATAAGGAGAGCAGCTGG + Intergenic
1133485560 16:6215229-6215251 AGGGGAAGAAGGAGAGGGAAGGG + Intronic
1133511949 16:6468065-6468087 GGGGGAATACGGAGTGGGGATGG + Intronic
1133594611 16:7279607-7279629 CTGGGAATAGAGAGGAGGGATGG + Intronic
1133622440 16:7539373-7539395 CTGGGAATAGAGAGAGATGAGGG - Intronic
1133733405 16:8595466-8595488 CTGGGAACTGGGAAAGGGGAAGG - Intergenic
1133837790 16:9381916-9381938 CTGGGTATAAGGAAAAAGGAGGG - Intergenic
1133959463 16:10480400-10480422 GTGGGGAAAAGAAGAGGGGAAGG - Intronic
1134060835 16:11198578-11198600 AGGGGAAAAAGGAGAGGAGAGGG + Intergenic
1134414240 16:14029989-14030011 CTGGGCATGGGGAGGGGGGAGGG + Intergenic
1134774113 16:16837085-16837107 CTGGGGGAAAGGAGAGGGGAGGG + Intergenic
1135288770 16:21216783-21216805 ATAGGATTAAGGAGATGGGAGGG + Intergenic
1136381505 16:29898184-29898206 CAGGGAGAAGGGAGAGGGGAGGG - Intronic
1136393086 16:29977639-29977661 CAGGGAATGAGGGGAGGAGATGG + Intronic
1136402861 16:30028046-30028068 CAGGGAAAGATGAGAGGGGAGGG + Intronic
1136487620 16:30583412-30583434 ATGGGAATGAGGAGAAGGAAAGG - Exonic
1136590292 16:31214423-31214445 CTGGGGCTAAGGCGAGGGCAAGG + Intronic
1137274235 16:46923087-46923109 CTGGGGCTAAGGGGAGGGCAGGG - Intronic
1137774201 16:51041944-51041966 CTGGGAAGTATGAGATGGGATGG + Intergenic
1137892176 16:52174331-52174353 ATGGGAAGATGGAGTGGGGAGGG + Intergenic
1138315879 16:56069705-56069727 CTGGGATTAAGGTCAGGGGCAGG - Intergenic
1138612981 16:58142122-58142144 CTGGGAATAAGCAGACAAGATGG - Intergenic
1138627728 16:58265935-58265957 GTGGGAGGAAGGAGAGTGGAGGG - Intronic
1139665059 16:68449205-68449227 ATGGGAAGACGGAGACGGGAAGG - Intergenic
1139724730 16:68887945-68887967 ATGGGAAAAAGTATAGGGGAAGG + Intronic
1139958894 16:70706422-70706444 CTGGCCATAGGGAGAAGGGAGGG - Intronic
1140107379 16:71973176-71973198 CTGGGCAAAAGGAGGGAGGAGGG - Intronic
1140880365 16:79192713-79192735 CTGAGAATAAGCAAAGGGGCTGG - Intronic
1140935549 16:79666364-79666386 CTGGGAACAGGGTGTGGGGAGGG - Intergenic
1141874417 16:86812728-86812750 CTGAGAATGTGGAGAGGGAAGGG + Intergenic
1141886484 16:86895787-86895809 CTGGGAAGAGGGAGAGAAGAGGG + Intergenic
1141942537 16:87287044-87287066 GTGGGAAAGAGGAGAGGAGAGGG + Intronic
1142112693 16:88340734-88340756 CTGGGAATCAGCAGAGGGGAGGG + Intergenic
1142145887 16:88492823-88492845 CTTGGGAGAAGGAGAGGGGCTGG - Intronic
1143250259 17:5518250-5518272 CTGGGATTTAGGAAAGGGGATGG - Intronic
1143707783 17:8711530-8711552 GTGGGAATCAGGAGAGGGAGGGG - Intergenic
1145742274 17:27285325-27285347 TTGGGGGTAAGGAGAGGAGAGGG + Intergenic
1145812775 17:27774490-27774512 GGGGGAATCAGGAGAGGGGCCGG + Intronic
1145961850 17:28891318-28891340 CAGGGAATAAGGCAAGTGGAGGG + Intronic
1146592628 17:34141245-34141267 CTGGGAATAAGGAGTGGTCCTGG + Intronic
1146725160 17:35150258-35150280 CTAGGAATGAAGAGAGGGGCTGG - Intronic
1147241592 17:39094250-39094272 CTGGGAGTAATGAGTGGGGATGG - Intronic
1147391470 17:40111922-40111944 CTGGGCTTAGGGAGAGGGAAAGG - Intergenic
1147403764 17:40196105-40196127 CTGGAACTCAGAAGAGGGGATGG + Intergenic
1147606397 17:41776071-41776093 CTGGAAATAAGGACAGGAGTGGG + Intronic
1147610346 17:41798342-41798364 CTGGGGACAGGGAGAGGAGAGGG - Intergenic
1147685300 17:42283538-42283560 CTGGGAATAGCATGAGGGGAAGG - Intergenic
1147782889 17:42956321-42956343 CTGGACTCAAGGAGAGGGGAGGG + Intronic
1147882477 17:43662982-43663004 ATGGGAATAACCAGTGGGGAAGG - Intergenic
1147935599 17:44008856-44008878 CTGGGGATTAGGGGAGGGGAGGG + Exonic
1147959311 17:44156606-44156628 CTAGGAAATAGGAGTGGGGAAGG - Intronic
1148486653 17:47995258-47995280 CTGGCAGTCAGGAGAGGGGGTGG - Intergenic
1148732419 17:49845569-49845591 CTGGGAATAGGGAGGGGGCTGGG + Intronic
1148749975 17:49940087-49940109 CTGGGAGTAGGGAGGGGGCAGGG + Intergenic
1149219305 17:54397749-54397771 CTGAGAATCAGGAGAGCTGATGG - Intergenic
1149650812 17:58275336-58275358 CTGCGAAGAAGGAGAGGGAAGGG + Intronic
1149654744 17:58304407-58304429 CAGGGAACAAAGAGAGGAGATGG + Intronic
1150191602 17:63246477-63246499 CTGGGAACTGGGAGAGGGAATGG - Intronic
1150300891 17:64046043-64046065 TTGGTAATAAGGAGAGGGTCAGG + Intronic
1151110677 17:71674377-71674399 CTGGTACTATGGAGAAGGGAGGG - Intergenic
1151347565 17:73511535-73511557 CTGGGGAGGAGGAGAGGGAAGGG + Intronic
1152271864 17:79329558-79329580 CAGGGAAGGAGGAGAGGGCACGG - Intronic
1203170791 17_GL000205v2_random:146466-146488 CAGGGACTAAGGAGAGAGGGTGG + Intergenic
1153132958 18:1878428-1878450 ATAGGAATAGGGGGAGGGGAAGG + Intergenic
1153769080 18:8401033-8401055 CTGGGGGTGGGGAGAGGGGATGG - Intronic
1153985646 18:10348628-10348650 CTGGGAGTGAGGAGTGGGAAGGG + Intergenic
1154145182 18:11861175-11861197 CTGGTACTGAGGAGAGAGGATGG - Intronic
1156305192 18:35872893-35872915 CTAGAAAGAAGGGGAGGGGAAGG - Intergenic
1156353790 18:36323486-36323508 CTGGGAATATGGGAAGGGGTGGG - Intronic
1156472206 18:37384384-37384406 CTGGGGATGAGGACAGGGGAGGG + Intronic
1157149595 18:45203180-45203202 GAGGGACTAAGGAGTGGGGAAGG + Intergenic
1157630754 18:49092960-49092982 CAGTGAATAAGGAGAGTTGAAGG + Intronic
1158388405 18:57021132-57021154 CTGAGAATAAGGTGGTGGGAAGG + Intronic
1158735445 18:60074528-60074550 CTGGGAATCAGGAGAGCTGATGG - Intergenic
1158897826 18:61931673-61931695 ACCGGAATAAGGAGATGGGAAGG - Intergenic
1159832166 18:73290269-73290291 TTGGGAATGAGGTGAGGTGAGGG - Intergenic
1160170872 18:76553111-76553133 GGGAGACTAAGGAGAGGGGATGG + Intergenic
1160181073 18:76636943-76636965 CTGGGAGGAAGGAGAAGGAATGG - Intergenic
1160696454 19:487110-487132 CTGGGAAGAAGGAAAAGGCAGGG - Intergenic
1160758691 19:771829-771851 CAGGGAGGAAGGAGAGGAGAGGG - Intergenic
1160758731 19:771948-771970 CAGGGAGGAAGGAGAGGAGAGGG - Intergenic
1160893228 19:1390420-1390442 CAGGGATGGAGGAGAGGGGAGGG + Intronic
1160983254 19:1826376-1826398 CTGGGAGTAGGGAGGAGGGAGGG + Intronic
1161918716 19:7250258-7250280 ATGGGAAGGAGGAGAGGGGAAGG + Intronic
1162036545 19:7943277-7943299 GTGGAAAAAAGTAGAGGGGAAGG - Intronic
1162362574 19:10228864-10228886 CTGGAGATTAGGAGAGGGGAAGG + Intronic
1162875441 19:13617842-13617864 TTGGGGATGAGGAGAGGGAAAGG - Intronic
1162982490 19:14248614-14248636 CTGGGGAGGGGGAGAGGGGATGG - Intergenic
1163013570 19:14440415-14440437 TTGGGAACAAGGAGAGGAGATGG + Intronic
1163116068 19:15189220-15189242 CTGGGAAAGAGGGGAGAGGAGGG - Intronic
1164062761 19:21689825-21689847 CTGGGAACAAGGAGTGGTGGTGG + Intergenic
1165920981 19:39297817-39297839 CTGGGGAGAAGGAGACAGGAGGG - Intronic
1166448069 19:42875864-42875886 CTGGCAATTATGAGAGTGGATGG + Intronic
1167476586 19:49704984-49705006 CTGGGGACCAGGAGAGGGGATGG - Intronic
1167642823 19:50691172-50691194 GTAGGAAAAGGGAGAGGGGAAGG + Intronic
1167702271 19:51056502-51056524 CTGGGAATAAGGAGCAGAGAAGG + Intronic
1167786728 19:51643673-51643695 CTGGGAGAAAGGAGAAGGTAAGG + Intronic
1168187318 19:54708548-54708570 CTGGGAATGAGGAGCGGGGGAGG + Intergenic
1168433796 19:56302283-56302305 GAGGGAAGAAGGAGAGAGGAAGG - Intronic
925102177 2:1256828-1256850 CTGGGACTTGGAAGAGGGGAGGG + Intronic
925719675 2:6814706-6814728 CTGGGGATAGAGAGAGGGTAGGG + Intergenic
928219241 2:29389524-29389546 CTGGCATTAAGGAGGTGGGAAGG - Intronic
928323261 2:30300663-30300685 CTGGACATGAGGAGATGGGATGG - Intronic
928423812 2:31161359-31161381 CTGGGCTTATGAAGAGGGGAAGG - Intergenic
928687346 2:33762178-33762200 CTGGGGAGAGGGAGAGGGGGAGG + Intergenic
929766725 2:44849946-44849968 CAGGGAAGAATAAGAGGGGAAGG - Intergenic
930079956 2:47438031-47438053 CTGGGTATCAGGAAAGGGAAGGG - Intronic
930171305 2:48254484-48254506 CTGAGAATAAGGAGGGGGAGAGG + Intergenic
930213547 2:48669107-48669129 CTGGAAATACAGAGTGGGGATGG - Intronic
930533201 2:52615461-52615483 ATGGGAAGCAGGAAAGGGGATGG - Intergenic
930765269 2:55078929-55078951 TTGGGAATAAGGAGAGGAAATGG + Intronic
930958121 2:57228482-57228504 GTGGGAAGGGGGAGAGGGGAGGG + Intergenic
931067831 2:58606790-58606812 CTGTGGAAAAGCAGAGGGGAAGG + Intergenic
932583569 2:73008355-73008377 GCGGGGAGAAGGAGAGGGGAGGG + Intronic
933230926 2:79806472-79806494 CTGGGAAGAAAGGGAGAGGAAGG + Intronic
934603119 2:95673570-95673592 AGAGGAATAATGAGAGGGGAAGG + Intergenic
934924577 2:98373148-98373170 CTGGGAAGCAGGGGAGGGGCTGG - Intronic
935037328 2:99391278-99391300 GAGGGAAGAAGGAGAGGGGTAGG + Intronic
935131652 2:100265288-100265310 CTGGGGAGAAGGAGAAGGGTGGG - Intergenic
935553056 2:104478801-104478823 ATGGGAAGAGGGAGAGGGAAAGG - Intergenic
935949541 2:108316332-108316354 GTGGGAAGAAGGAGAGGGAAAGG - Intergenic
936597987 2:113867512-113867534 CAGGGAACAAGGAGAAGAGAGGG - Intergenic
937373542 2:121319528-121319550 CTGGGAATTGGGTGAGGGGCAGG - Intergenic
937463348 2:122108491-122108513 ATGGGATTAAAGAGAGAGGAAGG + Intergenic
937812090 2:126210657-126210679 CTGGGAGGAAGAAGAGGAGAGGG + Intergenic
938220786 2:129565634-129565656 CTGGGAACAGGGAGTGTGGAGGG - Intergenic
938322989 2:130377637-130377659 CTGGGCCGAAGGAGAGGGTAGGG - Intergenic
940011733 2:149061534-149061556 CTGGGAGAAAGGACAGGGGGAGG + Intronic
940068337 2:149654773-149654795 CAGGAAATAAGGAGAGGGAATGG + Intergenic
940596040 2:155794803-155794825 CAGGGAAGCAGGAGAGAGGATGG + Intergenic
942082925 2:172418370-172418392 GTTGGAATAGGGAGAGGGCAGGG + Intergenic
942144109 2:173008958-173008980 CTGAGAATCAGAAGAGGTGAAGG - Intronic
942349612 2:175038903-175038925 TTGGGACAAAGGAGAAGGGAAGG - Intergenic
944866783 2:203870432-203870454 CTGGGGGTGTGGAGAGGGGAAGG + Intronic
945604420 2:211910585-211910607 GTGGGAAGATGGAGAGGGTAAGG + Intronic
945876980 2:215288040-215288062 GTGGGAAAAAGGAGAAGGGCAGG + Intergenic
945918118 2:215726144-215726166 GTGGGGACAGGGAGAGGGGAGGG + Intergenic
946302624 2:218833177-218833199 CTGGGAATAAGGCAAGGGAAGGG - Intergenic
946406320 2:219493799-219493821 CCAGGAATAAGGAGAGGTGAGGG - Intronic
947169219 2:227294467-227294489 CTGGAAATGAAGAGAGGGGAAGG - Intronic
947491458 2:230598746-230598768 TCGGGACTAAAGAGAGGGGAGGG + Intergenic
947605992 2:231485895-231485917 CTAAAAATAAGGAAAGGGGATGG + Intergenic
947616820 2:231563088-231563110 CTGGGACTAAGTAGTGGTGATGG + Intergenic
947836364 2:233178852-233178874 CTTGGAGCAAGGAGAGGGGTGGG + Intronic
947989391 2:234474781-234474803 CTTAGAACAAGAAGAGGGGAGGG - Intergenic
948031507 2:234821437-234821459 CTGGGACTAAGGAGATGGCCAGG + Intergenic
948299140 2:236888839-236888861 CTGGGTTTATGGCGAGGGGACGG + Intergenic
948455247 2:238101745-238101767 CTGGGACTGAGGTGAGAGGAGGG - Intronic
948915933 2:241035114-241035136 GTGGGAATAAGGGGAGAGTAGGG - Intronic
948927636 2:241109535-241109557 CTGGGAGGGAGGGGAGGGGAGGG + Intronic
949047005 2:241876905-241876927 CTGGGCAGAAGGGGTGGGGAGGG - Intergenic
1168900313 20:1358307-1358329 ATGGGAAGAAGGAGGAGGGAGGG + Intronic
1168955066 20:1828925-1828947 GGGGGAAGAGGGAGAGGGGAAGG - Intergenic
1169013502 20:2271956-2271978 CTGGGGCGCAGGAGAGGGGAGGG + Intergenic
1169185814 20:3616398-3616420 CTGGGAGCCATGAGAGGGGAGGG + Intronic
1169206826 20:3745322-3745344 GTGGGGCTAAGGAGAGGGGTCGG + Intronic
1169428479 20:5514268-5514290 GTGGGGATAAGGAAAGTGGAAGG + Intergenic
1169618084 20:7472197-7472219 CTGGGAAATAGAAGAGGGGGTGG + Intergenic
1169735812 20:8836386-8836408 CTGAGAATGAGGAGAGCTGATGG + Intronic
1170510082 20:17067475-17067497 CTGGGTGTTGGGAGAGGGGAGGG + Intergenic
1170938125 20:20827209-20827231 CAGGGAAGAGGGAGAGGGAAAGG + Intergenic
1171029406 20:21663819-21663841 CTGGGAAGAGGTAGAGGAGATGG + Intergenic
1171035469 20:21709517-21709539 CTGGGAAAAGGGAGAGCGGGTGG + Intronic
1171983725 20:31644966-31644988 CTGGGGTTAAGGGCAGGGGAGGG - Exonic
1172038260 20:32025692-32025714 TTGAGGATCAGGAGAGGGGAGGG + Intronic
1172970750 20:38871499-38871521 GTGGGAAGAAGGAGAGAGAAGGG + Intronic
1173132549 20:40408286-40408308 ATGGGAAAAAGGAGATGGAAGGG + Intergenic
1173367252 20:42397462-42397484 CTGGGAATTTCTAGAGGGGAAGG - Intronic
1173500216 20:43547928-43547950 CCGGGAGAAAGGAGAAGGGAGGG - Intronic
1173639692 20:44592229-44592251 TTGGGAAGAAGGAGAAGGGCCGG + Intronic
1173754420 20:45502901-45502923 CAGGGAAGAAGGAGAGGAGAGGG + Intergenic
1173915817 20:46708410-46708432 CTGGGATTCAGGAAAGGGGTAGG - Intergenic
1174171272 20:48619576-48619598 CTGGGTATCAGGGGAGGGGAGGG - Intergenic
1174342646 20:49907582-49907604 GTGGTAATCAAGAGAGGGGATGG - Intronic
1174403877 20:50291465-50291487 CTGGGACTGGGGTGAGGGGAAGG - Intergenic
1174565728 20:51463217-51463239 CTGGGAAGTGGGAGAGTGGAGGG + Intronic
1174806596 20:53608803-53608825 CTGGGAAGAAGGTGAGGCCAAGG - Intronic
1174976012 20:55335282-55335304 CTGGGGAAAAGGATATGGGATGG - Intergenic
1175391660 20:58631453-58631475 CTGGGGACAAGGGGAGTGGAGGG - Intergenic
1175998533 20:62821887-62821909 AAGGGAAAAGGGAGAGGGGAAGG - Intronic
1176119410 20:63447271-63447293 CCGAGAGTGAGGAGAGGGGAAGG - Intronic
1176270365 20:64233091-64233113 GAGGGAAGAAGGGGAGGGGAGGG - Intronic
1176330928 21:5547914-5547936 CAGGGACTAAGGAGAGGGGGTGG - Intergenic
1176396829 21:6273037-6273059 CAGGGACTAAGGAGAGGGGGTGG + Intergenic
1176440328 21:6716067-6716089 CAGGGACTAAGGAGAGGGGGTGG - Intergenic
1176464590 21:7043136-7043158 CAGGGACTAAGGAGAGGGGGTGG - Intergenic
1176488151 21:7424915-7424937 CAGGGACTAAGGAGAGGGGGTGG - Intergenic
1176668318 21:9707990-9708012 GTGGGAAGAGGGAGAGGGCAAGG + Intergenic
1176957627 21:15124331-15124353 CAGGGAAGAAGGAGGGGGAAGGG + Intergenic
1177861555 21:26460354-26460376 CTGGGCAGAAATAGAGGGGAGGG + Intergenic
1177943411 21:27438899-27438921 CTGAGAAAGAGGAGAGGAGAAGG - Intergenic
1177947700 21:27492483-27492505 CTGGGAATCTGGAAAGGGTAAGG - Intergenic
1178361029 21:31948616-31948638 GTGGGAAGGAGGAGAGAGGAAGG + Intronic
1178396895 21:32250729-32250751 CTGGGAAATAGGTGAGAGGAGGG - Intergenic
1178491837 21:33057507-33057529 CTGGGGATGCGGAGAGGAGAGGG - Intergenic
1178507545 21:33174973-33174995 CTGGTAATTGGGAGATGGGAGGG - Intergenic
1178640023 21:34338054-34338076 GTGGGCACACGGAGAGGGGAAGG + Intergenic
1179296504 21:40067709-40067731 GAGGGAATGAGGGGAGGGGAGGG - Intronic
1179791792 21:43760016-43760038 CTGGGAGTCCGGAGTGGGGACGG - Exonic
1181573219 22:23779054-23779076 CTGGGCAAATGGAGAGGGAAAGG - Intronic
1181695394 22:24590424-24590446 CTTTGGATAAGTAGAGGGGAGGG + Intronic
1181884650 22:26010663-26010685 CTGGGATGAAGGACAGAGGATGG - Intronic
1182096585 22:27630233-27630255 CTGTGGATTAGGAGAGGGGGTGG - Intergenic
1182274930 22:29182089-29182111 CTGGGAATCAGGAGAGAGGTGGG + Intergenic
1182550282 22:31097207-31097229 CTGGACATCAGGAGATGGGATGG - Intronic
1182599265 22:31447566-31447588 CTGCTGAAAAGGAGAGGGGAGGG + Intronic
1182812725 22:33131371-33131393 CTGGGAATAGGGATAAAGGAAGG - Intergenic
1183081240 22:35458035-35458057 CTGGGATTAGGGAGAGGTGGGGG + Intergenic
1183094133 22:35542086-35542108 CTGGGGACAAGGGGAGGGGAGGG - Intronic
1183388330 22:37527987-37528009 CGGGGCATGAGGAAAGGGGAGGG - Intergenic
1183485176 22:38084530-38084552 CTGGGAATGTGGGGGGGGGAGGG + Intergenic
1183578135 22:38705531-38705553 CTGGAAACAAGGAGAGTGAAGGG + Intergenic
1183792853 22:40087795-40087817 CAGGGAATTAGGAGAGGAGCTGG + Intronic
1184014377 22:41774899-41774921 CTGGGCAGAAGGAGAGGGATGGG - Intronic
1184087239 22:42272171-42272193 ATGGGAATAATCAGAGGGCAGGG - Intronic
1184193209 22:42908791-42908813 TTGGGAACAAGTAGAAGGGATGG - Intronic
1184718335 22:46294806-46294828 CTTGGAACCAGGAGAGGGGAAGG - Intergenic
1185292674 22:50035037-50035059 CAGGGAATAAGGAGAGGGTGGGG + Intronic
949171849 3:1009282-1009304 TTGGGAATAAAGAGAGAGAAAGG - Intergenic
949901443 3:8818134-8818156 CTGCGAATGAGGAGGAGGGAAGG - Intronic
950740261 3:15045306-15045328 CTGGGAATGAGAGGAGGGGCTGG - Exonic
951330606 3:21363928-21363950 AAGGGAATAAGAAGAGAGGAAGG + Intergenic
952771502 3:37005740-37005762 CTGGGAATAGGTAGAGAGAAGGG - Intronic
953042944 3:39271075-39271097 TTGGGAAAAAGGAATGGGGAAGG - Intronic
953135098 3:40175436-40175458 GTGGGAATAAGTTCAGGGGAGGG - Intronic
953651197 3:44806526-44806548 CTGAGAATGAGGAGAGAGAAAGG + Intronic
954364538 3:50139039-50139061 GTGTGAATAGGGGGAGGGGAAGG + Intergenic
954882271 3:53844343-53844365 CTTGGCAAAAGGATAGGGGAGGG - Intronic
955340230 3:58119740-58119762 CTAGGGAGAAGGAGAGGTGAGGG - Intronic
956184222 3:66547134-66547156 AAGGGAACAAGGAGAGGTGATGG - Intergenic
956373826 3:68592675-68592697 CAGGGAGTAAGGTGGGGGGAGGG - Intergenic
957080587 3:75632941-75632963 CAGGGACTAAGGAGAGAGGGTGG - Intergenic
957769036 3:84663935-84663957 CAGGGGAGAAGGAGAGAGGAAGG + Intergenic
957892322 3:86376494-86376516 CTGGGAATACTGAGAGGGTCCGG - Intergenic
958832094 3:99101571-99101593 CTGAGAACAAGGAGAGTTGAAGG + Intergenic
958991697 3:100853721-100853743 ATGGGAATAACGAGGGGAGATGG - Intronic
960048778 3:113221467-113221489 TGGGGAAGAAGCAGAGGGGAAGG - Intronic
960397159 3:117151587-117151609 CAGGGAAGAAGGGTAGGGGAAGG + Intergenic
960545423 3:118908779-118908801 CTGGAACTAAGGAGAAAGGATGG - Intronic
960551794 3:118984223-118984245 CTGGTTATAAGGGGAGGGGAAGG - Intronic
960803988 3:121565077-121565099 CTGGGACTAAGCAGAGTGGAAGG - Intergenic
960963113 3:123085689-123085711 CTGGGGAGAAGGAAAGGGGAAGG - Intronic
961025912 3:123557303-123557325 CTGGGGATAAGGGGAGGGGGTGG - Intronic
961287823 3:125820650-125820672 CTGGGGGAAAGGGGAGGGGATGG + Intergenic
961304017 3:125942967-125942989 TTGGGAATAGGGACAGGAGATGG + Intergenic
961899247 3:130195343-130195365 CTGGGGGAAAGGGGAGGGGATGG - Intergenic
961984090 3:131114004-131114026 CTGGGAATTTGGAGTGAGGAGGG + Intronic
962319207 3:134376987-134377009 CCGGGGCTAAGGAGAGGCGATGG - Intergenic
962573677 3:136736277-136736299 CTAGGGGCAAGGAGAGGGGAAGG + Intronic
962733895 3:138306919-138306941 CTGGGAATCATGAGAGGGTGAGG - Intronic
963044137 3:141090093-141090115 CTGGGAAGCAGGAGAAGAGAGGG - Intronic
963622115 3:147623732-147623754 ATGGGAATAAGGAGCAGAGATGG + Intergenic
964620342 3:158714947-158714969 CTGGGAAACTGGAGAAGGGAAGG + Intronic
964779138 3:160315716-160315738 CTGGGAATATGGAGAGTGGGAGG + Intronic
964833362 3:160910316-160910338 CTGTCAAAAAGGGGAGGGGAGGG - Intronic
964840541 3:160988930-160988952 CTAGTAATCAGAAGAGGGGAAGG + Intronic
964920877 3:161893743-161893765 GTGGGAATGAGGAGTGGTGAGGG + Intergenic
965338307 3:167455425-167455447 CTGGGGATAAGGGGAAAGGAAGG - Intronic
965520201 3:169662946-169662968 CTGGGGGGAAGGGGAGGGGAGGG + Intronic
965803975 3:172523547-172523569 CTGGGCAGTAGGAAAGGGGAGGG - Intergenic
966146140 3:176814047-176814069 CTGGGAATTAGAAGAAGGGAAGG - Intergenic
966204754 3:177394804-177394826 AGGGGAATGAGGGGAGGGGAGGG - Intergenic
966350591 3:179029893-179029915 CTGGGACTATGGTGAGGTGATGG - Intronic
967091908 3:186141882-186141904 CTGGGAACAAGGACCTGGGAAGG + Intronic
967296772 3:187973143-187973165 CTGAGAAGTAGGAGAGGGGCTGG - Intergenic
967365116 3:188677619-188677641 CTGGGAAATGGGAGAGGGGGAGG + Intronic
967715353 3:192756319-192756341 CTGGGAAGAAGGAGTGTGGTGGG + Intronic
968037899 3:195563677-195563699 CTGGGTATCTGTAGAGGGGAAGG - Intergenic
968886676 4:3338423-3338445 CTAGAAATGAGGGGAGGGGAAGG - Intronic
969370353 4:6727716-6727738 CGGGGAGGAAGGGGAGGGGAGGG - Intergenic
969847400 4:9930133-9930155 AAGGGAGGAAGGAGAGGGGAGGG - Intronic
969995036 4:11303213-11303235 CTGAGAATAAAGGGAAGGGATGG - Intergenic
970044853 4:11840577-11840599 CAGGGAAGAAAGAGAGGGGAAGG - Intergenic
970727034 4:19059454-19059476 CAGGAACCAAGGAGAGGGGAAGG + Intergenic
971032827 4:22659513-22659535 TTGAGAATAGGGAAAGGGGAAGG + Intergenic
971232894 4:24814810-24814832 GAGGGAATAAGGAGAGGAGTTGG - Intronic
971358178 4:25913526-25913548 CAGGGAACAGGGAGAGAGGATGG + Intronic
971832151 4:31708684-31708706 CTGAGACTAAGGACAGGGGCTGG + Intergenic
972238736 4:37165224-37165246 CTGGGAGTAAGGACAGCAGATGG - Intergenic
972285927 4:37648234-37648256 CTGGGAAGGAGGAGAGGGGGAGG + Intronic
972944491 4:44237323-44237345 ATGGGAAGAAAGAGAGAGGAAGG - Intronic
973829360 4:54742865-54742887 GTGGGAACAAGGAGAAGAGAAGG + Intergenic
975029150 4:69592193-69592215 CTGAGATTCAGGAGAGGAGAAGG - Intronic
975485577 4:74931682-74931704 CAGGGAGGATGGAGAGGGGATGG + Intergenic
976252673 4:83069208-83069230 GTGGGAATAAGGAGCTGGGAAGG - Intronic
976449832 4:85175686-85175708 CAGGGCTGAAGGAGAGGGGAGGG + Intergenic
976579691 4:86721676-86721698 CGGGGGAGAGGGAGAGGGGAAGG - Intronic
977080376 4:92519766-92519788 CTGAGAATAAGGAGAGCTGATGG + Intronic
978228322 4:106366011-106366033 CTGTGAATAAGGAGAGGAGCTGG - Intergenic
979360935 4:119764230-119764252 CTGGGAACCAGGAGAAGTGATGG - Intergenic
980556126 4:134408125-134408147 GAGGGAATTAGGAGAGGGGATGG - Intergenic
981225488 4:142289515-142289537 CTGGGAAGAGGGAGAGGATAAGG - Intronic
981341299 4:143624775-143624797 CTGGGAATTAGGACAGTGCATGG + Intronic
982391450 4:154868726-154868748 CTGAGAATCAGGAGAGCTGATGG - Intergenic
983552703 4:169033590-169033612 CTGGAATTAAAGAGAGGTGATGG + Intergenic
984588202 4:181587179-181587201 CTAGGAATAAGGAGAGAGTGCGG - Intergenic
984941191 4:184933546-184933568 ATGGGAATAAGGGCAGGGAAAGG + Intergenic
985051359 4:185995518-185995540 CTGAGAACCAGGAGAGCGGATGG + Intergenic
985282406 4:188300453-188300475 CAGGGAAGAAGGAGGAGGGATGG - Intergenic
985406463 4:189643505-189643527 GTGGGAAGAGGGAGAGGGCAGGG - Intergenic
985450327 4:190058274-190058296 CAGGGACTAAGGAGAGGGGGTGG + Intergenic
985542277 5:492550-492572 CTGGGAACGAGGAGAGTGCAGGG + Intronic
985543744 5:499031-499053 CTGGGGACCAAGAGAGGGGAAGG + Intronic
986229111 5:5845245-5845267 CTGAGAATAAGGACAAGGCAAGG - Intergenic
986270711 5:6228313-6228335 CTGGGGCTAGGAAGAGGGGAGGG + Intergenic
987424762 5:17760206-17760228 CAAGAAATGAGGAGAGGGGATGG + Intergenic
988398870 5:30734692-30734714 CTGAGAATGAGGAGAGCAGAGGG + Intergenic
988617505 5:32789606-32789628 CTGTGAATAGGGAGAAGTGAGGG - Exonic
989520442 5:42394766-42394788 GGGGGAGGAAGGAGAGGGGATGG - Intergenic
989807289 5:45624865-45624887 CTGGGAATAACTCTAGGGGAAGG + Intronic
990310546 5:54533893-54533915 CAGGGAGGAAGGAAAGGGGAGGG + Intronic
991486867 5:67145985-67146007 CTGGGACTAAGGAGGGGAAAGGG + Intronic
991649060 5:68833304-68833326 CTAGGAAAAAGGAGAGGGGAAGG + Intergenic
992022382 5:72637197-72637219 AAGGGAGAAAGGAGAGGGGAGGG + Intergenic
992132148 5:73704065-73704087 ATGGGAATATGGGGAGGGAATGG + Intronic
993387623 5:87278869-87278891 CAGGGAATAAGGAAAGAGGAAGG - Intronic
993815919 5:92545640-92545662 CTGGAAACAAAGAGAGGAGATGG + Intergenic
995374769 5:111461695-111461717 CTGGGAAGGAGGAGGGAGGAGGG - Intronic
995562300 5:113395901-113395923 CTGGGAAATGGGAGAGGGGAAGG + Intronic
995635852 5:114189294-114189316 CTGAGAACAAGGAGAGCTGATGG + Intergenic
995857950 5:116613670-116613692 CTGGGTATCAGGAGAGCTGAGGG - Intergenic
996387522 5:122925057-122925079 GAGGGAAAAGGGAGAGGGGAGGG - Intronic
996589618 5:125132102-125132124 CTGGGAACAAGGAGTGCTGATGG + Intergenic
996589638 5:125132200-125132222 CTGGGAATCAGGAGTGCTGATGG + Intergenic
996595626 5:125199371-125199393 CTGGGATGAAGTAGAGGGGGAGG - Intergenic
997607694 5:135186943-135186965 CTGGGAAGATGGGGAGGGGCAGG - Intronic
997763901 5:136479672-136479694 GTGGTATTGAGGAGAGGGGATGG + Intergenic
998045664 5:138984727-138984749 CTGGGTATAAGGGGATGGTAGGG - Intronic
998142064 5:139705656-139705678 CTGGGGGGAAAGAGAGGGGAGGG - Intergenic
998440110 5:142152548-142152570 CTGGGAGTAAGGAGAGGATTAGG + Exonic
998702791 5:144723473-144723495 TTGGGAGTAAGAAGAGGGCAGGG - Intergenic
999301400 5:150492896-150492918 CCGGGCATAAGGAGAGGGGGAGG - Intronic
999370552 5:151052516-151052538 CAGGGATGAAGGAGAAGGGATGG - Intronic
999446672 5:151645918-151645940 CTTTGACTAAGGAGAGAGGAAGG + Intergenic
999647954 5:153737914-153737936 CTGGGAATAAGAAATGGGGTAGG - Intronic
999708457 5:154295069-154295091 CTGGGAATCAGGGGAAGGGATGG - Intronic
1000040447 5:157481003-157481025 CTGGGAAGAAAAAGAAGGGAGGG + Intronic
1000621384 5:163489904-163489926 CTGGGAGTGGGAAGAGGGGAAGG + Intronic
1001545906 5:172570419-172570441 CTGGGAATCTGGAGAGGGGGAGG + Intergenic
1001868336 5:175125685-175125707 CAGGGGTGAAGGAGAGGGGAAGG - Intergenic
1002069502 5:176670912-176670934 CTGGAAATCAGGGGAGGAGAGGG + Intergenic
1002109948 5:176901895-176901917 ATGGGAATTTGGGGAGGGGAAGG - Intergenic
1002660112 5:180786042-180786064 CCAGGAAGCAGGAGAGGGGAAGG - Intergenic
1003162783 6:3650638-3650660 CTGGGAAACAGGAGTGGGGCTGG - Intergenic
1003347051 6:5279685-5279707 CTGAGAACCAGGAGAGTGGATGG + Intronic
1004753163 6:18584226-18584248 CTGGAAAGAAGGAGAGGCAATGG + Intergenic
1005201459 6:23349497-23349519 CTGGGAACAAAGAGAGGGACTGG + Intergenic
1005905346 6:30258396-30258418 CAGGGACTAAGGGGAGGGGAGGG + Intergenic
1005964891 6:30720332-30720354 GAGGGAGAAAGGAGAGGGGAGGG - Exonic
1006187325 6:32188860-32188882 CTGAGAACAAGGAGGGAGGAGGG + Intronic
1006590182 6:35149150-35149172 TGGGGAATGAGGAGAGTGGATGG + Intergenic
1006645479 6:35512043-35512065 CGGGGAGTGATGAGAGGGGAGGG - Intronic
1006682774 6:35809059-35809081 CTGGGAACAGGGAGGGGGCAGGG + Intronic
1007745806 6:44042383-44042405 CTGGGAGGGAGCAGAGGGGAGGG + Intergenic
1007790076 6:44303749-44303771 CAGGGAATAAGCAGGTGGGATGG + Intronic
1007870866 6:45036379-45036401 CTAAGAATAAGGAGAGTGGCTGG + Intronic
1008112929 6:47512383-47512405 CTGTGAATATGGAGTGTGGATGG + Intronic
1008808673 6:55464697-55464719 CTAGAAAGAAGGAGAGGGTAGGG - Intronic
1010175768 6:73026314-73026336 CTGGGTAAAAGGAGAGGGATAGG - Intronic
1011192450 6:84745284-84745306 CTGGTAATAAGCAGATGGGATGG - Intronic
1011404199 6:87000255-87000277 CTGGGAAAAAAGAGAGGTCAAGG - Intronic
1011730925 6:90262389-90262411 CTGGGAATGGGGCGTGGGGATGG - Intronic
1012383473 6:98648818-98648840 CTGGAAACTAGTAGAGGGGAAGG + Intergenic
1012557038 6:100526365-100526387 GTGGGTATAAGGAGAGGAGCAGG + Intronic
1012877921 6:104751471-104751493 CTGGTAATAAGCAGAGGGCATGG + Intronic
1013756460 6:113467539-113467561 ATGGGGACAGGGAGAGGGGAGGG - Intergenic
1013808970 6:114023187-114023209 CTGGGAATGAGAAGAGGGGATGG - Intergenic
1014176368 6:118335748-118335770 ATGGGAGGAAGGAGAGGGGAAGG + Intergenic
1014295299 6:119610194-119610216 ATGGGAAGAAGGAAAGGAGAAGG + Intergenic
1014608872 6:123515673-123515695 CTGGGAGCAAGGTGAGAGGAAGG + Intronic
1014664276 6:124217068-124217090 CTGGGAAAATGGTGAGAGGATGG + Intronic
1016093160 6:140003542-140003564 CTGAGAACCAGGAGAGTGGATGG - Intergenic
1016192134 6:141282539-141282561 CTGTGTAAAAGGAGATGGGATGG - Intergenic
1016286934 6:142484218-142484240 CTGGGAGTGGGGAGAGGAGAGGG - Intergenic
1016634795 6:146275558-146275580 ATAGGAAAAAGGAGAGAGGAAGG - Intronic
1016731231 6:147430581-147430603 CTGGGAACAAGAAGAGCTGATGG - Intergenic
1016902144 6:149113494-149113516 ATGGGAAGCTGGAGAGGGGATGG - Intergenic
1017117500 6:150992432-150992454 ATGGGAAGAAGTAGAGGGGTGGG + Intronic
1017230708 6:152070307-152070329 CTGGGAACAAGGACAGAGGGAGG - Intronic
1017324458 6:153130421-153130443 CTTTGACTAAGGGGAGGGGAAGG + Intronic
1017587871 6:155947041-155947063 CTGGGAACAGGGAGAGGACAGGG - Intergenic
1017944031 6:159078900-159078922 CTGGGATGAGGCAGAGGGGATGG + Intergenic
1018205609 6:161434918-161434940 CTGGGAGGAAGGAGAGGGGAGGG + Intronic
1018440201 6:163805524-163805546 CTGGTAATAAGGCAAGGAGAAGG - Intergenic
1018796118 6:167186861-167186883 GTGGGGAAAAGAAGAGGGGAAGG - Intronic
1018820203 6:167368196-167368218 GTGGGGAAAAGAAGAGGGGAAGG + Intronic
1019340783 7:507866-507888 CAGGGAAGGAGGGGAGGGGAGGG - Intronic
1019508221 7:1404112-1404134 CTGGGAACACGGAGAGGGGAGGG - Intergenic
1019686374 7:2384284-2384306 CTCAGAATAGGGAGTGGGGATGG + Intergenic
1020991014 7:15196046-15196068 CTGTCAAAAAGGAGAGGAGAGGG - Intergenic
1021239050 7:18178086-18178108 CTGTCAAAGAGGAGAGGGGAGGG - Intronic
1021785864 7:24152075-24152097 CTGGGGAGAAGGAGAAGGGATGG - Intergenic
1022144701 7:27525335-27525357 ATGGGAATAAAGAGAAAGGAGGG - Intergenic
1022424267 7:30253173-30253195 GTGGGCAGAAGGAGAAGGGAGGG - Intergenic
1022520790 7:31005656-31005678 CTGGGAGGAAGGAGACAGGAAGG + Intergenic
1022651991 7:32285815-32285837 GAGAGAATAAGGGGAGGGGAAGG + Intronic
1022711712 7:32856872-32856894 TTGGGATTAAGGAAAGGGAAGGG - Intergenic
1022912946 7:34918087-34918109 TTGGGATTAAGGAAAGGGAAGGG + Intergenic
1023111894 7:36821785-36821807 CTGAGAATCAGGAGAGCTGATGG + Intergenic
1023111900 7:36821834-36821856 CTGAGAATCAGGAGAGCTGATGG + Intergenic
1024395374 7:48860372-48860394 CTGAGAATAAGAAAAGGAGAAGG + Intergenic
1024399862 7:48911916-48911938 CTGAGAATAAGAAAAGGAGAAGG - Intergenic
1024777396 7:52803509-52803531 CTGAGGATAAGGAAAGGGGATGG - Intergenic
1025300856 7:57818886-57818908 CTGGGAATAAGGAGGAGGCCTGG - Intergenic
1026122513 7:67550296-67550318 GAGGGAGGAAGGAGAGGGGAGGG - Intergenic
1026211893 7:68313154-68313176 CAGGGAATGAGGAGTGAGGAAGG + Intergenic
1026322136 7:69277322-69277344 CTGGGAATCAGGGGAGTAGAAGG - Intergenic
1026414955 7:70170037-70170059 CTGGGAATCAGGAGAGGGGAGGG + Intronic
1026624365 7:71979213-71979235 CTAGGACTGGGGAGAGGGGATGG + Intronic
1027218362 7:76198557-76198579 CTGGGCAAAGGAAGAGGGGAGGG + Intergenic
1027540666 7:79460184-79460206 CTGGGAACATGGAGAGGAAAGGG + Intergenic
1028705582 7:93841189-93841211 GTGGGAGTAGGGAGAGGAGAGGG - Intronic
1029069190 7:97881422-97881444 CTGGGGGAAAGGGGAGGGGATGG - Intergenic
1029139558 7:98400604-98400626 CTGGGAGGAAGGAGAGGGCCAGG + Intronic
1029161306 7:98554223-98554245 GTGGGAGGCAGGAGAGGGGAGGG + Intergenic
1029448558 7:100627974-100627996 CCTGGAAAAAGGGGAGGGGAGGG + Exonic
1030235994 7:107262715-107262737 CTGAGAATAAGGAGGAGGGAAGG - Intronic
1030247777 7:107403659-107403681 AGGGGTAGAAGGAGAGGGGAAGG + Intronic
1030251879 7:107455440-107455462 CTGGTAAAAATGAAAGGGGAAGG + Intronic
1030605393 7:111633894-111633916 CTGGGAGTTAGGAGACGGGGTGG + Intergenic
1031083871 7:117283157-117283179 CTGGGACTCAGGAGAGAGGTGGG + Intronic
1031451871 7:121931442-121931464 CTGGGTTTAGGGAGAGTGGAGGG - Intronic
1031934443 7:127721717-127721739 CTGTGAATAAGGAGAGGAGAAGG + Intronic
1032278734 7:130483830-130483852 CAGGGAATAGGGAGAGTGGCAGG - Intergenic
1032531381 7:132623466-132623488 CTGGGAAGAATGAGAAGGAATGG + Intronic
1032648750 7:133854781-133854803 TAGGGAATAAGGAAAAGGGATGG - Intronic
1032753114 7:134862558-134862580 TTTGGAGTAAGGAGAGGGAAGGG + Intronic
1032760369 7:134934934-134934956 CTGGTAATAAAGAGGGGGAAAGG + Intronic
1033172441 7:139095956-139095978 CTGAGAAAAAGGAGAGTAGATGG + Intronic
1033187419 7:139240998-139241020 CTGGGAATAAAGAGAGGCATGGG - Intronic
1033281850 7:140011665-140011687 CAGGGACCAGGGAGAGGGGAGGG + Intronic
1033658882 7:143390555-143390577 CTGGGAAGAAGGAAGGGTGAGGG - Intronic
1034175879 7:149099395-149099417 CTGTGAATTTGGAAAGGGGAGGG + Intergenic
1035019312 7:155791351-155791373 CTGGGAGGAAGAAGAGGGGGAGG - Intergenic
1035332789 7:158107330-158107352 CAGGGACTTAGGAGGGGGGAGGG - Intronic
1035987335 8:4449343-4449365 CTGGAAAAAAAGAGAGGGGGAGG - Intronic
1036224904 8:6949534-6949556 GTGGGAATCAGGGGAGGGAAAGG + Intergenic
1036251446 8:7166193-7166215 CTGGGGGAAAGGGGAGGGGATGG - Intergenic
1036366042 8:8121267-8121289 CTGGGGGAAAGGGGAGGGGATGG + Intergenic
1036701734 8:11017691-11017713 CTGGGAAACACGAGAGGGGCAGG + Intronic
1036884895 8:12544813-12544835 CTGGGGGAAAGGGGAGGGGATGG - Intergenic
1037542204 8:19883048-19883070 CTGGGAACCAGGAGAGCTGATGG + Intergenic
1037995459 8:23349136-23349158 CTGGGAATTGGGAGTGGGAATGG - Intronic
1038104458 8:24416751-24416773 CTGAGGTTAAGGAGAAGGGAGGG - Intergenic
1038661576 8:29501953-29501975 ATAGGTACAAGGAGAGGGGATGG + Intergenic
1039604767 8:38871343-38871365 GGGGGAATAAGAAGAGGGGAAGG + Intergenic
1039858518 8:41436815-41436837 CTGGGTATAAAGAGAGAAGAAGG + Intergenic
1040004827 8:42610999-42611021 CAGGAATTAGGGAGAGGGGAAGG + Intergenic
1040845617 8:51835232-51835254 AAGGGTAGAAGGAGAGGGGAAGG - Intronic
1041158360 8:55011161-55011183 ATGGAAACAAGGAGAGCGGAAGG + Intergenic
1041354999 8:56991055-56991077 CTGGGCATTAGGAGAGGGGAAGG + Intronic
1041357486 8:57015505-57015527 TTGAGATTAAGGAGAGAGGAGGG + Intergenic
1041945264 8:63433698-63433720 CAGGGAATATGGAGAGCAGAGGG + Intergenic
1041962338 8:63632991-63633013 ATGGTAATGAGGGGAGGGGAAGG + Intergenic
1041998882 8:64097676-64097698 ATGGGAATATGGAGAAGAGAGGG + Intergenic
1041998890 8:64097727-64097749 ATGGGAATATGGAGAAGAGAGGG + Intergenic
1042335197 8:67622560-67622582 CTGGGAATGAGGAGAAGACAGGG + Intronic
1042476011 8:69247909-69247931 CTAGGAGTGAGGAGAGGAGATGG - Intergenic
1042678480 8:71350738-71350760 CTTGGAGTAAGGAGTGAGGAAGG - Intronic
1042810992 8:72824779-72824801 CTGGGAAGAGAGAGAGTGGATGG + Intronic
1043267283 8:78282316-78282338 CTGGGACTCAGGAGAGGAAAGGG + Intergenic
1044905656 8:96999370-96999392 CTGGGAAGAGGGAGAGGACAAGG - Intronic
1045278623 8:100729130-100729152 CTTGGAATAAGGAAAGGAAAGGG + Intergenic
1045345676 8:101291438-101291460 CTGGGGATGGGGAGAGGGGTAGG + Intergenic
1045399657 8:101800868-101800890 GGAGGAAAAAGGAGAGGGGAGGG + Intronic
1045520465 8:102898659-102898681 CTGGGAGGAAGGAGAGAAGAGGG + Intronic
1045773633 8:105775308-105775330 GAGGGAAAAAGAAGAGGGGAGGG - Intronic
1045948869 8:107829264-107829286 CTGAGAATGAGGAGATGGTAGGG + Intergenic
1046095595 8:109556062-109556084 CTGGAATAAAGGAGAGGGAATGG - Intronic
1046953978 8:120044573-120044595 CTGTGAATAGGGGGAGGGCAGGG + Intronic
1047181462 8:122592805-122592827 CTGCGTATAAGGAAAGGGGTGGG - Intergenic
1047468304 8:125141642-125141664 TTGGGAATGAAGAGAGGAGAAGG - Intronic
1048236146 8:132692707-132692729 CTGGGAATTGGGAGAGGGTCAGG - Intronic
1048286014 8:133142416-133142438 CTGGGAAGATGGGGAGGTGATGG - Intergenic
1048524386 8:135187916-135187938 CTGGGAATAATCAGAGGCAATGG + Intergenic
1048541621 8:135347116-135347138 AGGGGAGGAAGGAGAGGGGAGGG + Intergenic
1048586821 8:135781872-135781894 TTGGGGATAGGGAGGGGGGAAGG - Intergenic
1048933554 8:139336580-139336602 CTGGGAACAAGGAGCGGGCCAGG + Intergenic
1049370304 8:142261180-142261202 GTGGGAGGAAGGAGAGAGGAAGG + Intronic
1049844424 8:144793032-144793054 CGAGGAAGAAGGAGCGGGGATGG + Intergenic
1050055988 9:1655128-1655150 CTGGGAACTACTAGAGGGGAGGG - Intergenic
1051804064 9:20971758-20971780 CAGGGGATAGGGAGAGGGGTGGG - Intronic
1052082315 9:24222371-24222393 CTGTGAATAGGCAGAGAGGATGG - Intergenic
1052354536 9:27490633-27490655 CTGGGAGTAAGGAGTGGGAGAGG + Intronic
1053000077 9:34573161-34573183 CTGGGCATGGGGTGAGGGGAGGG - Intronic
1053350801 9:37412153-37412175 GTGGGAAGCAGGAGAGGGGAGGG - Intergenic
1053495103 9:38543936-38543958 AGGGTAATATGGAGAGGGGAGGG - Intronic
1055621126 9:78126127-78126149 GTGGGAGGAGGGAGAGGGGAAGG - Intergenic
1055786964 9:79881555-79881577 GGGGGAAGAAGGAGAGGGGAGGG - Intergenic
1056071191 9:82988668-82988690 GAGGGAGCAAGGAGAGGGGAGGG - Intronic
1056254812 9:84788371-84788393 CTGGGACTATAGAGAGGAGAAGG + Intronic
1056548903 9:87635483-87635505 CCAGGAAGAAGGTGAGGGGAAGG - Intronic
1056680355 9:88712216-88712238 CTAGGAAGAAGAAGAGGGCAAGG + Intergenic
1056817394 9:89811724-89811746 CTGGGAGCAAAGAGAGGGGGAGG + Intergenic
1057527099 9:95812508-95812530 CTGGGAAAAAGAAAAGAGGATGG - Intergenic
1057809493 9:98246835-98246857 CTGGGAAGATGGGGTGGGGAAGG + Intronic
1057878923 9:98778528-98778550 CTGGGCCCCAGGAGAGGGGAGGG - Intronic
1057908246 9:98998976-98998998 CTGGGAAGAAGGAGGTGGGGTGG - Intronic
1057987025 9:99727345-99727367 CTGGGGGTAAGGATGGGGGATGG + Intergenic
1058668922 9:107344262-107344284 CTGGGACTGAGGAGTGAGGAAGG + Intergenic
1058735332 9:107888939-107888961 CTGGGCAGAAGGAGAGGGCTGGG - Intergenic
1060010538 9:120039696-120039718 GGGGGAAGAGGGAGAGGGGAAGG + Intergenic
1060470719 9:123945885-123945907 CAGGGAAAAGGGCGAGGGGAAGG + Intergenic
1060982539 9:127802202-127802224 CTGGGAAGAGGGAGAGGGGAAGG + Intronic
1061008992 9:127944281-127944303 CTGGGAGGAAGTAGAAGGGAGGG + Intronic
1061213469 9:129206670-129206692 CTGGGAGCAAAGAAAGGGGAAGG + Intergenic
1061264426 9:129497097-129497119 AGGGGAATGGGGAGAGGGGAGGG + Intergenic
1061281688 9:129601354-129601376 GGGGGAAGAAGGAGAGAGGAGGG + Intergenic
1061671261 9:132189568-132189590 CAGGGAAGAAGGGCAGGGGAAGG + Intronic
1061921533 9:133785159-133785181 CTGGTGAAATGGAGAGGGGAAGG - Intronic
1062037738 9:134390186-134390208 CTGGGCTTAAGGGAAGGGGAGGG + Intronic
1062137082 9:134934887-134934909 CTGGGACAGAGGAAAGGGGAAGG - Intergenic
1062182261 9:135196757-135196779 GTGGGAAGAAGAAGAGGGAAGGG - Intergenic
1062236992 9:135515089-135515111 CCAGGAATAAGGAGAAGGAAGGG - Intergenic
1062434330 9:136540002-136540024 CTTGGGAGAAGGAGAGGGGCAGG + Intronic
1062448038 9:136603972-136603994 CTGGGGATGAGGAGAGGAGGAGG + Intergenic
1062502793 9:136858490-136858512 CTGGGGGTAACGAGAGGGGGTGG - Exonic
1062697917 9:137884865-137884887 GGGGGAAGAAGGGGAGGGGAAGG - Intronic
1203435341 Un_GL000195v1:132211-132233 CAGGGACTAAGGAGAGAGGGTGG - Intergenic
1203657548 Un_KI270753v1:12965-12987 GTGGGAAGAGGGAGAGGGCAAGG - Intergenic
1185459878 X:328961-328983 CGGGGAGAGAGGAGAGGGGAGGG - Intergenic
1186623837 X:11270472-11270494 CCAGGAATAAGGAGAGGGACAGG + Intronic
1186776622 X:12871519-12871541 CTGGGAGAAACCAGAGGGGATGG - Intronic
1187066759 X:15847956-15847978 CTGTGGATAAGGAGCGAGGATGG - Intronic
1187266224 X:17736900-17736922 CTTGGAATGAGGAGAGGGGCGGG - Intergenic
1187346907 X:18473841-18473863 CTGGGGGTGGGGAGAGGGGATGG + Intronic
1187527390 X:20066386-20066408 GTGGGAATGAGGAAGGGGGATGG + Intronic
1188330644 X:28866971-28866993 CTGAGAATAAGAAGGAGGGATGG + Intronic
1188624038 X:32262340-32262362 CTGGGAATCAAGGGAGGGGCAGG + Intronic
1189104027 X:38219165-38219187 ATGAGAGAAAGGAGAGGGGAGGG + Intronic
1189184102 X:39036983-39037005 CTGGCAATGAGTAGAGGGGTTGG + Intergenic
1189354107 X:40298581-40298603 CTGGGCAGATGGAGAGGGGGAGG - Intergenic
1190634206 X:52418486-52418508 CTGGCAATAAGGAGAGGCAAAGG + Intergenic
1190816896 X:53937482-53937504 CTGGGCAGAAACAGAGGGGAGGG + Exonic
1190912849 X:54788447-54788469 CTGGGGAAGAGGAGAGAGGATGG - Intronic
1190918105 X:54824923-54824945 CTGGGGAAGAGGAGAGAGGATGG + Intergenic
1191025514 X:55908924-55908946 TTGGTAAGAAGGGGAGGGGAAGG + Intergenic
1191103753 X:56759737-56759759 CTGGGAATAAGCACAGGCCAAGG - Intergenic
1192151537 X:68715748-68715770 GAGGGAAGAGGGAGAGGGGAGGG - Intronic
1192175277 X:68881202-68881224 GTGGGAAGCAGGAGATGGGAAGG + Intergenic
1192243783 X:69357005-69357027 CTATGCATGAGGAGAGGGGAGGG + Intergenic
1192567426 X:72176965-72176987 CTGGGAACAAGGACAGGAAAAGG - Intergenic
1192764231 X:74125970-74125992 CTGGGTATAAGGTGAGAGGATGG + Intergenic
1194792990 X:98174101-98174123 CTGGGAAGAAAGAGAAGGGGAGG - Intergenic
1195164120 X:102201074-102201096 CTGGGATTAAGTAGTGGTGATGG - Intergenic
1195194740 X:102486021-102486043 CTGGGATTAAGTAGTGGTGATGG + Intergenic
1195613495 X:106894825-106894847 GGGGGAATAAGGAGGAGGGAAGG + Intronic
1196440707 X:115717608-115717630 CTGGAAAGAAGGGGAGGGGAGGG - Intergenic
1196857732 X:119999768-119999790 CTGGAAAGGAGGAGAGGGAAAGG + Intergenic
1196920709 X:120582675-120582697 CTTGGAATAAGTTGGGGGGAAGG - Intergenic
1198301363 X:135336775-135336797 CTGGGAATAAGGAGAGGGGAAGG - Intronic
1198517466 X:137424476-137424498 CTGGCCTTTAGGAGAGGGGATGG - Intergenic
1199710646 X:150466837-150466859 CTGGGAGTAAGGTGCAGGGATGG - Intronic
1199767804 X:150953615-150953637 CTGTGAATGAGGAGAGGACATGG - Intergenic
1200073546 X:153540481-153540503 CGGGGAAGAAGCAGTGGGGAGGG - Intronic
1200176765 X:154122463-154122485 CATGGAATAAGGTGATGGGATGG + Intergenic
1200740594 Y:6849808-6849830 CTGGGAAGGAAGATAGGGGAGGG + Intergenic
1201451122 Y:14116124-14116146 GAGGGAAGGAGGAGAGGGGAGGG + Intergenic
1201951360 Y:19567633-19567655 CCGGGAATAAGGCGACGGCAGGG - Intergenic
1202302006 Y:23426543-23426565 CTGGGAGTAGGGAGAAGAGATGG - Intergenic
1202568805 Y:26244055-26244077 CTGGGAGTAGGGAGAAGAGATGG + Intergenic