ID: 1198301622

View in Genome Browser
Species Human (GRCh38)
Location X:135339177-135339199
Sequence TCTTATCTGTTGAAGATAGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 268
Summary {0: 1, 1: 0, 2: 0, 3: 14, 4: 253}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1198301622_1198301624 -9 Left 1198301622 X:135339177-135339199 CCCTCTATCTTCAACAGATAAGA 0: 1
1: 0
2: 0
3: 14
4: 253
Right 1198301624 X:135339191-135339213 CAGATAAGACTGACTCTTCCTGG 0: 1
1: 0
2: 1
3: 15
4: 144
1198301622_1198301630 21 Left 1198301622 X:135339177-135339199 CCCTCTATCTTCAACAGATAAGA 0: 1
1: 0
2: 0
3: 14
4: 253
Right 1198301630 X:135339221-135339243 CACACAGATGGTGGTATTGATGG 0: 1
1: 0
2: 0
3: 32
4: 205
1198301622_1198301627 9 Left 1198301622 X:135339177-135339199 CCCTCTATCTTCAACAGATAAGA 0: 1
1: 0
2: 0
3: 14
4: 253
Right 1198301627 X:135339209-135339231 CCTGGCCTTTGGCACACAGATGG 0: 1
1: 0
2: 0
3: 26
4: 289
1198301622_1198301628 12 Left 1198301622 X:135339177-135339199 CCCTCTATCTTCAACAGATAAGA 0: 1
1: 0
2: 0
3: 14
4: 253
Right 1198301628 X:135339212-135339234 GGCCTTTGGCACACAGATGGTGG 0: 1
1: 0
2: 2
3: 14
4: 186
1198301622_1198301625 -2 Left 1198301622 X:135339177-135339199 CCCTCTATCTTCAACAGATAAGA 0: 1
1: 0
2: 0
3: 14
4: 253
Right 1198301625 X:135339198-135339220 GACTGACTCTTCCTGGCCTTTGG 0: 1
1: 0
2: 0
3: 22
4: 208

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1198301622 Original CRISPR TCTTATCTGTTGAAGATAGA GGG (reversed) Intronic
900430618 1:2600821-2600843 TCTTATTTGTTGCTGATATATGG - Intronic
903900263 1:26639319-26639341 TCTTAATTGTTTAAGATAGTTGG - Intergenic
911265018 1:95733245-95733267 TCTTTTCAGCTGAACATAGAGGG + Intergenic
912158117 1:106947359-106947381 TCTTATCTTAATAAGATAGAAGG + Intergenic
912889676 1:113516077-113516099 ACTCTTCTGTTGGAGATAGAAGG - Intronic
912925270 1:113907408-113907430 TCATATGTGATGAAGTTAGAAGG - Intronic
917818783 1:178739147-178739169 TCCTATCTCTTAAAGCTAGAGGG + Intronic
918806011 1:189046380-189046402 TCTTATCTTCTGGAAATAGATGG - Intergenic
919000094 1:191819936-191819958 TCTTATCAGGTAAAGATAAATGG + Intergenic
919235909 1:194842324-194842346 TCTCATCTGCTGAAGCTGGAGGG + Intergenic
922531413 1:226348133-226348155 TTTTATCTGTTGGAGCTGGAAGG - Intergenic
924950643 1:248879569-248879591 TCTTATCTTTTGTAGAGACAGGG + Intergenic
1063405749 10:5793165-5793187 TCTTATTTTTTGAAGAGACAGGG + Intronic
1063700418 10:8379062-8379084 TCTTCGCTTTTGAAAATAGATGG + Intergenic
1064756212 10:18573634-18573656 TCAAATCTGATGAAGATATAGGG + Intronic
1068294265 10:55048105-55048127 TCTTATATGTTTAAGAAAAAAGG + Intronic
1071168868 10:82839981-82840003 TTTTAACTGTTGAAGAAGGAAGG - Intronic
1071736979 10:88311905-88311927 TCTTATCTCTTGCAGATAGCAGG + Intronic
1072780834 10:98250506-98250528 TTTTAACCCTTGAAGATAGAGGG + Intronic
1073044920 10:100631442-100631464 ACTTAGCTGTTGAGGAAAGAGGG + Intergenic
1073822841 10:107284837-107284859 TCTTTTCTCTTGGAGATAAAAGG - Intergenic
1075171230 10:120117052-120117074 TCTTGTCTGTTGAACACATAAGG + Intergenic
1076739327 10:132474583-132474605 TATTATCTGTTGACCGTAGATGG - Intergenic
1077666151 11:4111613-4111635 TCTTATTTGTTGAAGATCAATGG + Exonic
1078349489 11:10580933-10580955 TCTCATCTGTAAAAGAGAGAGGG + Intronic
1078801534 11:14649765-14649787 TTTTATATGTTGAAGACAGAGGG + Intronic
1078845231 11:15114276-15114298 TCTTATGTGCCGAAGTTAGAAGG + Intronic
1079795307 11:24794964-24794986 TTATTTGTGTTGAAGATAGAGGG + Intronic
1080919205 11:36692021-36692043 CCTTAACCGTTGAAGATAGTGGG + Intergenic
1081053344 11:38374556-38374578 TCATGTCTGTTGAAGAAACATGG - Intergenic
1081503869 11:43694844-43694866 TCTTATTTGTTAAAAATACATGG - Intronic
1082046320 11:47731784-47731806 TCTCATCTGTTGGAGTGAGAGGG - Intronic
1082644469 11:55704483-55704505 TCTTATAGGCAGAAGATAGATGG - Intergenic
1086143957 11:83530118-83530140 TCTTATTTGTTTGAGATAGATGG - Intronic
1086966158 11:93030684-93030706 TCTTATTTGTAGAAAATATATGG + Intergenic
1087692487 11:101337745-101337767 TCTTATCAGTTTATGAAAGACGG - Intergenic
1091955977 12:4643478-4643500 TGTTATCTATTAAAGATAAATGG + Intronic
1093183975 12:15999006-15999028 TCTAATATGTTGAAGATGAAAGG - Intronic
1093294885 12:17377046-17377068 TTTTATCTGTTAAGGAAAGAGGG + Intergenic
1094402171 12:30073951-30073973 TCTTTTCTGTTGCAGGTATATGG - Intergenic
1094643980 12:32303105-32303127 TCTTATTTTTTGTAGAGAGAGGG + Intronic
1096342098 12:50809470-50809492 ACTTATCTTCTGAAGATACACGG + Exonic
1096431616 12:51548940-51548962 TCTTATCTGTTGGAGAATCAGGG - Intergenic
1103119629 12:118371016-118371038 TTTGATCTGTTGGAGATAGTTGG - Intronic
1104701821 12:130910548-130910570 TTTTATCTTTTGAAGAGACAGGG - Intergenic
1106151302 13:27105607-27105629 TGTTAGCTGTTGAAGAAACAAGG - Intronic
1107960226 13:45550721-45550743 TCTTGGCTTTTGATGATAGACGG + Intronic
1108832232 13:54494523-54494545 TATTACCTATAGAAGATAGATGG + Intergenic
1108880920 13:55114612-55114634 TATAGTCTATTGAAGATAGACGG - Intergenic
1109634237 13:65092568-65092590 TTTTTTGTTTTGAAGATAGATGG + Intergenic
1109679060 13:65722708-65722730 TTTCAGCTGTAGAAGATAGAAGG + Intergenic
1109697093 13:65975414-65975436 TCTTATCTGTTAAAGAAATGAGG - Intergenic
1110034382 13:70662234-70662256 TCTTATAAGATGAAAATAGAAGG - Intergenic
1110109257 13:71722983-71723005 TCTGCTCTTTTGAATATAGATGG - Intronic
1110747524 13:79072089-79072111 TCTTAAGTCTTGAAGACAGAAGG + Intergenic
1111131859 13:83987031-83987053 TTTTATCTTTGGAAGAGAGAAGG + Intergenic
1111150717 13:84251029-84251051 TCTTATCTGTTGGTTATTGAAGG + Intergenic
1112037131 13:95507197-95507219 GTTTATCTGTTGAAGATGGTAGG - Intronic
1112146710 13:96708326-96708348 TCTTATATGCTCTAGATAGAAGG - Intronic
1112414541 13:99193406-99193428 TCTTATTTGTTGTAGAGACAGGG - Intergenic
1118471540 14:66079407-66079429 TCTTTTCTGTGGAAGCCAGAGGG + Intergenic
1119969643 14:78955386-78955408 TCTAATCAGTTGAAAATACAGGG + Intronic
1121414913 14:93772745-93772767 TCTTTCCTGTTGAAGATGCAGGG + Intronic
1122576933 14:102748752-102748774 TTTTATCTTTTGTAGAGAGAGGG + Intergenic
1123223369 14:106877252-106877274 CCTTATTTGTTGAATTTAGATGG + Intergenic
1124448437 15:29761762-29761784 TATTTTCTGTTGCAGATAAATGG - Exonic
1125195750 15:37044103-37044125 TCTTATCTGTAGAATGGAGATGG - Intronic
1125330212 15:38574835-38574857 GCTTACCTGGTGAAAATAGATGG - Intergenic
1125464283 15:39934926-39934948 TCTTAGCTGTAGTAGAGAGAGGG + Intronic
1127512258 15:59654441-59654463 TCTTATAGGTTGATTATAGAAGG - Intronic
1128869839 15:71146049-71146071 CCTTATCTGTTGTACATAAAAGG - Intronic
1130154881 15:81341673-81341695 TCTTATCTTTAGAAGGTGGAGGG - Intronic
1130821669 15:87502584-87502606 TCTTTTCTGGTGAAGTAAGAGGG - Intergenic
1131807612 15:96138854-96138876 TCTTATTCGTTGAACATAGTGGG + Intergenic
1132208972 15:100006497-100006519 TATTTTATGTTGAATATAGAGGG + Intronic
1133577105 16:7102642-7102664 TGTTCACTGTTGAAAATAGATGG - Intronic
1135902668 16:26477953-26477975 TCGTATGTGTGGAAGAAAGAAGG + Intergenic
1138166702 16:54808758-54808780 TTTTATCTGTTGATGCTAGTGGG + Intergenic
1139286415 16:65818467-65818489 TCATATCTGTTAAACCTAGAGGG - Intergenic
1141362306 16:83407073-83407095 AATTATCTGTTGAATATACATGG - Intronic
1143118550 17:4593805-4593827 TCTTCTCTGTGGAAGAGAGAGGG - Exonic
1146010326 17:29189018-29189040 ACTTATTTGTTGAAGAAACATGG + Intergenic
1147967555 17:44200995-44201017 TCTTATCTCTTGAGGGGAGAGGG - Intergenic
1148183369 17:45622726-45622748 TCTAATCTCTTGTACATAGATGG + Intergenic
1148265483 17:46222964-46222986 TCTAATCTCTTGTACATAGATGG - Intronic
1153296568 18:3551978-3552000 TTTTATTTTTTGTAGATAGAGGG + Intronic
1153610671 18:6881052-6881074 TCTTATCAGTAGAGGTTAGAGGG + Intronic
1155037535 18:22037568-22037590 TCTGCCCTGTTGAAGCTAGAAGG + Intergenic
1156320050 18:36011416-36011438 TTTTACATGTTGAAGATATAAGG - Intronic
1158190044 18:54817260-54817282 TCTTATATGTTCAAAATAGAAGG - Intronic
1158526142 18:58216148-58216170 TCTTCTCTGCTGATGATAAATGG - Intronic
1162456065 19:10785611-10785633 TTTTATCTTTTGTAGAGAGAAGG + Intronic
1166749380 19:45157586-45157608 TTTTATCTTTTGTAGATACAGGG + Intronic
1167877267 19:52424630-52424652 TGTGATGTGTTGAAAATAGAGGG - Intergenic
926822438 2:16867227-16867249 TTTTATGTTTTGAAGATACAGGG + Intergenic
929880780 2:45835765-45835787 TCTTATTTTTTGTAGAGAGAAGG + Intronic
930350292 2:50244597-50244619 TCCTATCTGCTGAAGAGAAAAGG - Intronic
932087159 2:68772591-68772613 TCTTATCTGTCCTAGAAAGAGGG - Intronic
936787358 2:116110111-116110133 TCCTATCTCTTGAAGGGAGAGGG + Intergenic
937195029 2:120146488-120146510 TCGAATCAGTTGAAGATAAATGG - Intronic
937605195 2:123792080-123792102 TCTTATCTGTAGAATGCAGATGG - Intergenic
937725910 2:125166395-125166417 TCTTTTCTGTTTAAGAAAGCAGG + Intergenic
937959779 2:127448361-127448383 TCTTATCTGTAGAAGAACAATGG - Intronic
938123514 2:128652610-128652632 TTTTATCTGTTGTTGAGAGATGG + Intergenic
941279184 2:163529077-163529099 TCTTATCTGTTCAGGGTAGTTGG + Intergenic
941833458 2:169989052-169989074 TAATCACTGTTGAAGATAGATGG - Intronic
942414071 2:175740008-175740030 TCATAATTGTTGAAGCTAGATGG - Intergenic
943405361 2:187476510-187476532 TTTTATCTTTTGTAGAGAGAGGG + Intronic
945314387 2:208355936-208355958 TCTTCTCTGTGGAAGACAGGAGG + Exonic
945497486 2:210526485-210526507 TCTTATCTGTAAAAGAGAGAAGG + Intronic
945668536 2:212773241-212773263 AGTTATTTGTTGAAGACAGAGGG - Intergenic
946139085 2:217672871-217672893 TCTTAGCTGGAGAATATAGAGGG - Intronic
946790550 2:223296901-223296923 TCTTATCTCCTGTAGATAAAGGG + Intergenic
946835965 2:223772698-223772720 TATTATCTGCTGAAGACAGACGG - Intronic
947300378 2:228682433-228682455 TCTTATCTTTAGAAAATAGGGGG + Intergenic
947560737 2:231148482-231148504 TCTTACCTGGTGCAGATACATGG + Intronic
947622199 2:231597925-231597947 TCTTTGCTGTTGGAGAGAGAAGG + Intergenic
1168932074 20:1631968-1631990 TCTTATCTCTTGTGGCTAGAGGG + Intronic
1169635886 20:7690992-7691014 GCTAATCTGTTGAGGTTAGAAGG + Intergenic
1169835628 20:9874564-9874586 TCTTATCAGTGGAAGCTAGCAGG - Intergenic
1169852023 20:10062799-10062821 TCTTATTTACTGAAGATAAAAGG - Intergenic
1170141304 20:13127603-13127625 TCTTATCTGTTTTATATAGTAGG - Intronic
1170632908 20:18080689-18080711 ACTTATTTGTTGAAGAAAGCAGG + Intergenic
1170824737 20:19783809-19783831 TCTCATCAGTTGTAGATTGAGGG + Intergenic
1171119292 20:22554494-22554516 GCTTATTTGTTGAAGAAACAAGG + Intergenic
1171235895 20:23524346-23524368 TCTTATCTGATCAGGAGAGAAGG + Intergenic
1173296804 20:41766909-41766931 TCTTATCTTTGGAACCTAGAGGG + Intergenic
1173365598 20:42381818-42381840 TTTTCTGTGTTGAAGGTAGAAGG - Intronic
1174815782 20:53685790-53685812 TCTTGTTTGTTTAAAATAGATGG - Intergenic
1177698785 21:24609701-24609723 TCAAATCTGTTGCAGATAAATGG - Intergenic
1178255220 21:31046137-31046159 TCTTATATCCTGATGATAGAAGG + Intergenic
1179341961 21:40520286-40520308 TATTTTCTCTTGAAGAAAGATGG - Intronic
1184857034 22:47151929-47151951 TCTCAGCTTCTGAAGATAGAAGG + Intronic
1185256242 22:49834153-49834175 TTTAATTTGTTGAAGATAGATGG + Intergenic
949903627 3:8839994-8840016 TCTTCTCTGTCGGAGACAGATGG + Intronic
951240477 3:20280734-20280756 TCTTATCTGAGGAATTTAGAAGG - Intergenic
951411066 3:22367692-22367714 TCATTTCAGTTGAGGATAGATGG + Intronic
952982085 3:38744852-38744874 TCTGATCTGTGGAAGAGAAATGG - Intronic
954469492 3:50679933-50679955 TCTCATCTGTTTAAAAAAGAGGG - Intronic
954967970 3:54627635-54627657 TCTTATGTTTTGAATGTAGAAGG + Intronic
957163927 3:76646262-76646284 TCTTGTCTGTGGAAGAGTGACGG + Intronic
957876413 3:86152654-86152676 TCTTATCTGCTTAATATAGTAGG + Intergenic
958262595 3:91399580-91399602 TCTTATAGGCTGAAGATAAATGG - Intergenic
958463590 3:94429511-94429533 TCTTATCTGTAGCAGAAAGCAGG - Intergenic
958623325 3:96591859-96591881 TCTTCACTGTTTAGGATAGAGGG - Intergenic
958903334 3:99914100-99914122 TCTGATTTGTTGAAAATAGTGGG - Intronic
959202265 3:103261918-103261940 TCTTCTGGGTGGAAGATAGATGG - Intergenic
960938398 3:122917477-122917499 TCTTATCTCTTGAAGCTTCAGGG + Intronic
962020471 3:131495441-131495463 TTTTATATCTTGAAGAAAGAAGG + Intronic
962160483 3:132994356-132994378 TATTATTGGTTGAAAATAGATGG + Intergenic
963198983 3:142567534-142567556 TCATATCTGTTGAAATTACATGG - Intronic
964628945 3:158788315-158788337 TCTTTTCTGTTATAGAGAGAGGG - Intronic
965190699 3:165525085-165525107 TCTTTTCTGTTCAAGATATGTGG + Intergenic
966012129 3:175092649-175092671 TATCATATGTTGAATATAGATGG + Intronic
966084546 3:176053362-176053384 TATTAACTGTTAAAGAAAGATGG + Intergenic
966949670 3:184804758-184804780 TCTTATCTTTTGTAGAGATAGGG + Intergenic
967189038 3:186969554-186969576 ACTTATCTGTAGAATATATAAGG - Intronic
968310869 3:197682180-197682202 TCTTCTCTTTCTAAGATAGATGG - Intronic
970094702 4:12449815-12449837 TCAAATCTTTTGAAAATAGATGG + Intergenic
970210006 4:13699648-13699670 TCAGCTTTGTTGAAGATAGATGG + Intergenic
971776866 4:30977127-30977149 TCATACCTGTTGTATATAGAAGG - Intronic
972243423 4:37218992-37219014 TCTTATCTGTTATAAAAAGAGGG + Intergenic
972347604 4:38205951-38205973 TCTTATCTCTTGAATAGGGAGGG - Intergenic
974030841 4:56775035-56775057 TTTTATTTGTAGAAGATACAGGG - Intergenic
974360611 4:60873651-60873673 TCTTGTCAGTTCAAAATAGAAGG - Intergenic
975018925 4:69463029-69463051 TCTTATATGTTGAATAATGAAGG + Intergenic
978109371 4:104944197-104944219 TCTTTTCTGATGTATATAGAAGG + Intergenic
980397494 4:132233233-132233255 TCTTATCTTTTGGAGTCAGAAGG - Intergenic
983233631 4:165154699-165154721 GCTTATCTTTTCAAGATAGATGG + Intronic
984532454 4:180933539-180933561 TTTTATTTGTTGTAGATAGGGGG - Intergenic
986689618 5:10303465-10303487 TTATATCTGTTGAAGAGTGATGG - Intronic
987024423 5:13909963-13909985 GCTTATATGTGGAATATAGATGG - Intronic
987179040 5:15347176-15347198 TCATATGTGTTGTAGATAGCTGG + Intergenic
988053276 5:26057936-26057958 TCTTATTTTTTAAAGATTGAAGG + Intergenic
988126935 5:27052939-27052961 TAATAGCTGTTTAAGATAGAAGG + Intronic
990994133 5:61713976-61713998 ACTTTTCTGTTGGAGAAAGAAGG + Intronic
992491470 5:77248400-77248422 TCTTAATTCTTGAGGATAGAAGG - Intronic
992935775 5:81702979-81703001 ACTTGTCTGTTGTAGATAGTGGG - Intronic
993019998 5:82580503-82580525 TCAGGTTTGTTGAAGATAGATGG + Intergenic
993100007 5:83526415-83526437 TTTTGTCTGTTCAAGATACAGGG - Intronic
993273455 5:85825184-85825206 TCTTATCTCTTGCAGATATTAGG + Intergenic
993354028 5:86883610-86883632 GTTTATCTGTTGGATATAGATGG - Intergenic
994527875 5:100929129-100929151 TCTTATTTCCTAAAGATAGAGGG - Intergenic
995082099 5:108063921-108063943 TATTATCTCTTGGAGATAAATGG + Intronic
999351655 5:150876943-150876965 TCTTATATGATGAAGAAAAAAGG - Intronic
1000106810 5:158067699-158067721 TCTTTTTTTTTGTAGATAGAAGG - Intergenic
1000513586 5:162212963-162212985 TTTAATCTTTTGAAGATACAGGG - Intergenic
1000649139 5:163794269-163794291 TCTTATCTCTTCAAAATACATGG + Intergenic
1000931654 5:167259305-167259327 TATAATCTGTAGAAGATAGGTGG - Intergenic
1001321411 5:170685321-170685343 TCTTATTTGTTGATCATAGTTGG - Intronic
1001439369 5:171727727-171727749 TCTAATCTGTAGAAAAGAGAGGG + Intergenic
1001521216 5:172394927-172394949 TCCTACCTGATGAAGAAAGAAGG + Intronic
1002873980 6:1194373-1194395 TCTTATCTATTGATGGAAGATGG - Intergenic
1006321949 6:33324475-33324497 TCTTACCTGTTTAAAATAAAGGG + Intronic
1006663089 6:35665711-35665733 TGTGATCTGTTGAAGTTAGGTGG - Intronic
1007053443 6:38857022-38857044 ACTTATCTATAGAAGAGAGAGGG - Intronic
1008055605 6:46942516-46942538 TCTTATGTGTAAAAGAGAGACGG + Intronic
1008992820 6:57623299-57623321 TCTTATAGGCTGAAGATAAATGG + Intronic
1009181441 6:60522417-60522439 TCTTATAGGCTGAAGATAAATGG + Intergenic
1009420924 6:63463966-63463988 TCTTATCTTTTACAGATAAATGG + Intergenic
1010155664 6:72789328-72789350 TCTCATATGTTAAACATAGAGGG - Intronic
1010515713 6:76770681-76770703 TCTTATCTGTAGAAGAGGAAAGG - Intergenic
1012188218 6:96248144-96248166 TCTTATCTGTAGCACATAGTAGG + Intergenic
1012269101 6:97185423-97185445 TCTTAGATGCTGAAGATAAATGG - Intronic
1012502930 6:99909807-99909829 TGTTATCTGTTGCAGGTAGGTGG + Intergenic
1012666658 6:101979429-101979451 ACTTATCTGTTAAAGGTGGAAGG + Intronic
1014024433 6:116628687-116628709 TTTTATATGTTTAATATAGATGG + Intronic
1014400142 6:120978142-120978164 TCCTATCTGTTTTGGATAGATGG - Intergenic
1015503459 6:133956965-133956987 TCTTTTCTTTAGAAGACAGATGG + Intronic
1016550199 6:145270991-145271013 TCTGCTATGTTGAAGATAGAAGG - Intergenic
1016891310 6:149009990-149010012 ACTTATATTTTAAAGATAGATGG - Intronic
1018218422 6:161553177-161553199 ATTTATCTGTTGAAGAAAGCAGG + Intronic
1019998755 7:4742587-4742609 TCTTATCTTTTGTAGAGACAGGG + Intronic
1020766718 7:12331192-12331214 TCTTATCTGTAGTAGGAAGAAGG + Exonic
1024712358 7:52030703-52030725 GCATATGTGTTGAAGACAGATGG - Intergenic
1026821671 7:73553868-73553890 TCTAATCTGGTGTAGATAGTTGG - Intronic
1028705092 7:93833159-93833181 TGTTATCTGCTGAGAATAGATGG - Intronic
1030562751 7:111111461-111111483 CCTTATGTGTTGAATAGAGAGGG - Intronic
1031175586 7:118344451-118344473 TCTTTTGTTTTGAAGATACACGG + Intergenic
1031492902 7:122411119-122411141 TCTGATCTGCTGATGGTAGATGG - Intronic
1031891800 7:127303014-127303036 TCTTATTTTTTGTAGATATAGGG + Intergenic
1033291443 7:140087038-140087060 TCTTGTCTGTTGAAGATGTCTGG + Exonic
1036098135 8:5747706-5747728 TCTTCTCTATGGAAGATGGAAGG + Intergenic
1038453772 8:27658023-27658045 TCTTATCTGACGCAAATAGAAGG + Intronic
1039165540 8:34675438-34675460 ACTTTACTGTTGCAGATAGAGGG - Intergenic
1039378252 8:37059116-37059138 TTTTAAATGTTGAAGCTAGAAGG + Intergenic
1039405060 8:37305516-37305538 TCTTATCTTTTGTAGAGACAGGG + Intergenic
1039559972 8:38504935-38504957 TCTTATCTGTGAAAGAGGGATGG + Intergenic
1040700368 8:50056240-50056262 TTTTATCTGTGGAACATAGTAGG - Intronic
1043254082 8:78110895-78110917 TCTTAGCTGTAGAAAATAAAGGG + Intergenic
1043575883 8:81655751-81655773 TCTTTTCTGTTGAAGATTTTAGG - Intergenic
1045072622 8:98525105-98525127 TCTTATCTTTTGAAGCAACATGG + Intronic
1045542731 8:103102000-103102022 TATTTGCTGTTGAAGATAAAAGG + Intergenic
1046326612 8:112656190-112656212 TGTTGTCTGTTGTAAATAGAAGG + Exonic
1046465722 8:114600375-114600397 TCTGATCATTTGTAGATAGATGG - Intergenic
1047897385 8:129381906-129381928 TCTTCTCTTTTGAAAAAAGATGG - Intergenic
1048722808 8:137346055-137346077 TCTTATAAGTGGAAGATAGAAGG - Intergenic
1050199030 9:3121717-3121739 TTTTAATTGTTGAAGGTAGAGGG - Intergenic
1050477331 9:6053656-6053678 TCTTATCTGCTAAATATTGAGGG + Intergenic
1051855764 9:21563009-21563031 TATTATCTGTTCAAACTAGATGG + Intergenic
1052096154 9:24386862-24386884 TCTTATTTTTTGAAGAAATATGG - Intergenic
1052339205 9:27348775-27348797 TCTAGTCTGTAGAAGATACATGG + Intronic
1056047340 9:82732809-82732831 TTTTTTCTGTTGAAAATAGCTGG - Intergenic
1056459509 9:86795884-86795906 TCTCATCTGGTGAAGAAAGATGG + Intergenic
1058364839 9:104196697-104196719 GATTATTTGTGGAAGATAGATGG - Intergenic
1058371099 9:104268737-104268759 AAATATCTGTTGAAGAAAGAAGG - Intergenic
1059558371 9:115306020-115306042 TTTTACCTGTTGAAGATAAGGGG - Intronic
1059997576 9:119927264-119927286 TGTTAGGTGTTGAAGATACAGGG - Intergenic
1060459923 9:123841804-123841826 TCTGATATATTGAATATAGAGGG + Intronic
1186317783 X:8389177-8389199 TCTTCTCTGTTGGAGAAGGAGGG + Intergenic
1186491242 X:9974662-9974684 TCTTTTTTTTTGCAGATAGAAGG + Intergenic
1186553884 X:10536640-10536662 TCTTTTCTGTAGAATCTAGAAGG + Intronic
1187527284 X:20065688-20065710 TCTTATTTGTTGTAGATATTTGG - Intronic
1187852427 X:23604559-23604581 TATTGTCTGTGGTAGATAGATGG - Intergenic
1188315579 X:28669074-28669096 TCTGATATGTTGAACAAAGATGG + Intronic
1188810864 X:34653089-34653111 TCTTAGGTGTTAAAGATAAATGG - Intronic
1188867771 X:35335036-35335058 TGGTATTTGTTGAAAATAGATGG - Intergenic
1188873408 X:35400976-35400998 TCCTATCTGGTGAAGGCAGAGGG - Intergenic
1191095709 X:56671205-56671227 AGTTATCTGTGGAAGATAGCAGG + Intergenic
1193044242 X:77034602-77034624 GCTTATCTTTTTATGATAGATGG - Intergenic
1193472331 X:81922223-81922245 TTTTATCCATTGAAAATAGAAGG + Intergenic
1193787721 X:85780609-85780631 TATTATGTGTTGAAGATCAATGG + Intergenic
1197084567 X:122456363-122456385 TCTTATCTCCTGTAGATAAAGGG - Intergenic
1197116147 X:122835966-122835988 TCTTATCTCTTAGAGATAGATGG + Intergenic
1197170373 X:123427215-123427237 TCTTCTCACTTGAAGATAAATGG - Intronic
1197996285 X:132378376-132378398 TCTTCTCTGTTGATCACAGAGGG - Exonic
1198301622 X:135339177-135339199 TCTTATCTGTTGAAGATAGAGGG - Intronic
1198934038 X:141887847-141887869 TGTTATCTGCAGAAGATTGAAGG - Intronic