ID: 1198301669

View in Genome Browser
Species Human (GRCh38)
Location X:135339513-135339535
Sequence CAGAGCTACCAGTAGGATGT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 161
Summary {0: 1, 1: 0, 2: 0, 3: 12, 4: 148}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1198301661_1198301669 17 Left 1198301661 X:135339473-135339495 CCTCTTGTTGGTGTGGGGCACTG 0: 1
1: 1
2: 0
3: 10
4: 134
Right 1198301669 X:135339513-135339535 CAGAGCTACCAGTAGGATGTGGG 0: 1
1: 0
2: 0
3: 12
4: 148
1198301657_1198301669 27 Left 1198301657 X:135339463-135339485 CCTGTTGCTGCCTCTTGTTGGTG 0: 1
1: 0
2: 0
3: 24
4: 177
Right 1198301669 X:135339513-135339535 CAGAGCTACCAGTAGGATGTGGG 0: 1
1: 0
2: 0
3: 12
4: 148

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1198301669 Original CRISPR CAGAGCTACCAGTAGGATGT GGG Intronic
900599333 1:3496433-3496455 CAGAGCTAGCAGAAGCCTGTGGG + Intronic
901689514 1:10963628-10963650 AAGAGCTCACAGTTGGATGTGGG + Intronic
902409277 1:16203360-16203382 CATAGCTACCAGATGGGTGTAGG - Intronic
903108829 1:21110224-21110246 AAGAGCTCCCTGTAGAATGTTGG - Intronic
903372923 1:22848441-22848463 CTGAGCTACCAGGAGGATGCTGG + Intronic
903376251 1:22868078-22868100 CAGAGCTCCCAAATGGATGTAGG - Intronic
908301228 1:62762278-62762300 CAGATCAATCAGCAGGATGTGGG + Intergenic
908498716 1:64721642-64721664 CAGAGCTGCTGGTAGGCTGTGGG - Intergenic
909516216 1:76510215-76510237 CAGAGCTCCTAGTATGCTGTGGG - Intronic
912626081 1:111205182-111205204 CAGATCTCCCAGGAGGAAGTGGG - Intronic
913088514 1:115460204-115460226 CAGAGATGCCAGAAGGAAGTGGG - Intergenic
913127656 1:115807949-115807971 CAAAGATACCTGTGGGATGTTGG + Intergenic
917282516 1:173392147-173392169 CAGAGCTACTAGTAGAGTGCAGG - Intergenic
917406455 1:174712174-174712196 CAGACCAATCAGCAGGATGTGGG + Intronic
918388675 1:184036712-184036734 CAGGGCTAGCAGTATGAGGTGGG + Intronic
921083767 1:211767574-211767596 CAGAGCTACCAGTTGGAAAATGG - Intronic
922775978 1:228214356-228214378 CAGTGCTGCCTGGAGGATGTGGG + Exonic
1063161299 10:3420814-3420836 CAGAGCCAGAGGTAGGATGTAGG + Intergenic
1063202791 10:3801216-3801238 GAGAGCTTCCAGCAGGATTTGGG - Intergenic
1065023918 10:21523809-21523831 CAGTGCTCCCAGAAGGATTTGGG - Exonic
1068075957 10:52254199-52254221 CAGAGTTAGGAGTAAGATGTAGG + Intronic
1069280091 10:66644910-66644932 CTGAGCTAGCAGGAGGATGTGGG - Intronic
1074018232 10:109557494-109557516 CAGAGCTTGCAGGAGGAAGTAGG - Intergenic
1076121767 10:127941901-127941923 CAGAGCCACCAGTGAGAAGTTGG + Intronic
1077805210 11:5584048-5584070 CAGAACAACCATTATGATGTCGG - Intronic
1077840360 11:5967878-5967900 CAGAGCTACCAGTTTGTTATAGG - Exonic
1078668322 11:13343978-13344000 TAGAGCTACCAGTTGAATTTGGG + Intronic
1081033820 11:38116877-38116899 TGGACCAACCAGTAGGATGTGGG + Intergenic
1085905218 11:80751982-80752004 AAGAGCTACCATTAGATTGTTGG + Intergenic
1089376756 11:118000059-118000081 CAGAGCTTCCAGCAGGAGGAAGG + Exonic
1091156966 11:133383075-133383097 CAGGGTGACCAGGAGGATGTTGG - Intronic
1093528005 12:20125889-20125911 CAGAGCTTCAAGTAAGAAGTGGG - Intergenic
1093950338 12:25158367-25158389 CATAGCTACCAGTAATATTTAGG - Intronic
1094800376 12:34026260-34026282 CAGAAATCCCAGAAGGATGTAGG - Exonic
1095113165 12:38320558-38320580 CAGAAATCCCAGAAGGATGTAGG - Exonic
1095583582 12:43827197-43827219 CAGAGCATCAAGAAGGATGTGGG - Intergenic
1095739515 12:45591879-45591901 CAGAGCTACCTTTATGATGCAGG + Intergenic
1097183000 12:57181441-57181463 CAGTGCCTCCAGTAGGATTTTGG + Intronic
1099616146 12:84938361-84938383 CAGAGCAACAAGCAGGGTGTTGG + Intergenic
1103444077 12:120982507-120982529 CAGAGCTAGGATTAGGATGCAGG - Intronic
1104660384 12:130607889-130607911 GGGAGCTCCCAGCAGGATGTGGG + Intronic
1104721782 12:131048485-131048507 CAGCGCTTCCCGTAGGCTGTGGG - Intronic
1107302042 13:38976221-38976243 CAGGGCCACCAGGAGAATGTGGG - Intronic
1110262580 13:73502039-73502061 CAGAGCTAGGAGCAGGATTTAGG + Intergenic
1114571816 14:23674673-23674695 CAGAGCCATCAGTGGAATGTTGG - Intergenic
1114783727 14:25570121-25570143 CAGAGCAACAAGTAGGCTCTTGG - Intergenic
1114824516 14:26060671-26060693 CAGAGCCACCAGTTGGAAATAGG + Intergenic
1115060886 14:29188249-29188271 TAGAGCTACCAGTAGGCTGCTGG - Intergenic
1125133408 15:36311820-36311842 CAGAGCTACAATTTGGATGTAGG + Intergenic
1125892515 15:43276921-43276943 CAGAGCCACCATTAAGGTGTTGG + Exonic
1127839846 15:62821626-62821648 CAGAGCGACTATTAGGAGGTTGG - Intronic
1129305193 15:74655694-74655716 AACAGCAACCAGCAGGATGTGGG + Intronic
1132366430 15:101261075-101261097 CAGAGCTCCCTGTGGGATCTTGG - Intergenic
1132631297 16:918923-918945 CAGAGACACCTGTGGGATGTGGG + Intronic
1138654004 16:58480061-58480083 CAGACCAACCTGTAGGAGGTGGG + Intronic
1139960521 16:70714939-70714961 CAGAGCTTCCAGTGGGACGGAGG - Intronic
1143095982 17:4478624-4478646 CACACCTACCAGCAGGATGTCGG - Exonic
1150628357 17:66858349-66858371 CAGAGCTGCTATAAGGATGTAGG - Intronic
1153797738 18:8640374-8640396 CAGAGGTACCAGTGGCATCTGGG + Intergenic
1158600033 18:58848845-58848867 CACAGCTCCCAGGAGGAAGTGGG + Intergenic
1160199953 18:76788160-76788182 CAGACCAATCAGCAGGATGTGGG - Intergenic
1162044246 19:7988165-7988187 CAGAGCTACCAAGTGGATGGTGG + Intronic
1162341647 19:10094860-10094882 CAGTGACACCAGTAGGATGCTGG - Exonic
1163753988 19:19095790-19095812 CACAGCTACCAGCGGGTTGTGGG - Intronic
1165052503 19:33150958-33150980 CAGAGCTGCCAGTCTGATGGAGG - Intronic
1165846740 19:38822772-38822794 CGGACCAACCAGCAGGATGTGGG + Intronic
926222639 2:10946361-10946383 CTGTGCTTCCAGTAGGCTGTAGG - Intergenic
941476476 2:165956632-165956654 CAGACCAATCAGTAGGATGTGGG - Intergenic
944364490 2:198901307-198901329 CAGAGCTACAAGTTGGTTCTTGG + Intergenic
945234219 2:207619686-207619708 CAGAGTTACCATTAGCATTTTGG - Intronic
948532502 2:238618833-238618855 CAGAGCTAGCAGTGGGTGGTGGG + Intergenic
948974974 2:241458400-241458422 CAGGGCTACCCGTGGGATGCTGG + Intronic
1172556826 20:35849437-35849459 TAGAGCTACCAGGAGGAGGCAGG + Intronic
1176150466 20:63588239-63588261 CAGAACTTCCAGTGGGTTGTGGG - Exonic
1176709308 21:10135934-10135956 CAGGGCTAACTCTAGGATGTGGG - Intergenic
1179055110 21:37924518-37924540 CAGAAGTCCCAGCAGGATGTGGG + Intergenic
1179219025 21:39390135-39390157 CAGAGGTGGGAGTAGGATGTTGG + Intronic
1179409665 21:41153048-41153070 CAGAGTGGCCAGCAGGATGTGGG + Intergenic
1180216333 21:46325371-46325393 CAGAGCTCCCAGGAGGGTGGAGG + Intronic
1181682395 22:24504660-24504682 CAGTCCTACTATTAGGATGTTGG + Intronic
1182265313 22:29110189-29110211 CAGAGCTCCCAGTTGAATGCAGG - Intronic
1182510809 22:30818863-30818885 CAGAGCAACCAGTTTGATGTGGG + Intronic
1183969921 22:41469154-41469176 CCGAGTCACCAGTAGGCTGTAGG - Exonic
949114323 3:301416-301438 CAGAACAGCCAGTAGGAGGTTGG - Intronic
949263730 3:2133077-2133099 CAGAGCAATCAGTAGTAGGTTGG + Intronic
951848448 3:27111026-27111048 CAGAGCTACCAGTGTGCTGCTGG - Intronic
954111414 3:48435429-48435451 CAGAGAGACCTGGAGGATGTAGG - Intronic
954943253 3:54394031-54394053 CAGAGTTACCACTATGAGGTAGG + Intronic
956619079 3:71202287-71202309 AAGTGCTAACAGTAGTATGTAGG + Intronic
956985491 3:74694515-74694537 TAGAGATACCAGTAGGAAGTAGG + Intergenic
957308223 3:78486687-78486709 AATAGCTACCACTAGGATGTGGG + Intergenic
960982878 3:123248181-123248203 TAGAACTTCCAGTATGATGTTGG - Intronic
961448539 3:126992209-126992231 CAGAGCTTCCTGGAGGGTGTGGG + Intronic
964184296 3:153924137-153924159 CGGACCAACGAGTAGGATGTGGG - Intergenic
967266821 3:187698772-187698794 CAGTGCTACGAGGAGGATGGTGG - Exonic
970920221 4:21385302-21385324 CAGAACCACCAGCAGGAGGTGGG + Intronic
971449155 4:26784033-26784055 CAGGGCTTCCAGGAGGATGGAGG - Intergenic
978694330 4:111558610-111558632 CAGAACTTCCAGTACTATGTTGG + Intergenic
979291153 4:118980449-118980471 CACAGCTCCCAGGAGGATGCAGG - Intronic
979573545 4:122258744-122258766 CAGAGCTACCAGGTGGAGGCCGG - Exonic
980916161 4:139035091-139035113 CTGAGCGACCAGAAGGATGGAGG - Intronic
981265749 4:142781356-142781378 CAGTACAACCAGTGGGATGTGGG - Intronic
983881314 4:172936397-172936419 CAGAGCTTCCAATACTATGTTGG - Intronic
984867636 4:184295571-184295593 CAGGGCTACCATTAGGGTGTTGG - Intergenic
985898237 5:2763395-2763417 CAGTGTTAGCAGTGGGATGTGGG - Intergenic
986004796 5:3658840-3658862 CAAAACTACCAGTAGGAAATTGG - Intergenic
987019681 5:13856984-13857006 CAGAACTACCAATACTATGTTGG - Intronic
990153964 5:52853159-52853181 CAGAGCAACCAAAAAGATGTGGG + Intronic
992880879 5:81108457-81108479 CAGAGGTACTAGTAAAATGTGGG + Intronic
996980355 5:129484763-129484785 CATAGCTATCAGTAAGATTTTGG + Intronic
998079252 5:139261042-139261064 AGGAGCTCCCAGTTGGATGTGGG - Intronic
1003896888 6:10616444-10616466 CAGACCAATCAGCAGGATGTGGG - Intronic
1004622242 6:17341274-17341296 CGGACCAACCAGCAGGATGTGGG - Intergenic
1007229239 6:40336868-40336890 CAGAGCAACCAGAAGGATGGGGG + Intergenic
1009888800 6:69656090-69656112 CAAAGGTACCTGTAGGAGGTGGG - Intergenic
1011212580 6:84969999-84970021 CAGAGATATAAGTAGGTTGTAGG - Intergenic
1011974871 6:93283331-93283353 CAGACCAATCAGCAGGATGTGGG + Intronic
1012661130 6:101894464-101894486 AAGAGCTACCATTAGAATTTTGG - Intronic
1014598881 6:123383750-123383772 CACAACTACCATTAGTATGTTGG - Intronic
1021948399 7:25751048-25751070 CAGAGCAACACGTAGGATTTTGG + Intergenic
1027541918 7:79477567-79477589 CACAGCTGCCAGCAAGATGTCGG - Intergenic
1027779071 7:82500378-82500400 CAGACCAATCAGCAGGATGTGGG + Intergenic
1029402713 7:100355745-100355767 CAGAGCTACCCAGAGGCTGTTGG + Intronic
1029405417 7:100371959-100371981 CAGAGCTACCCAGAGGCTGTTGG + Intronic
1030097492 7:105913491-105913513 CACTGCTACCAGCAGGGTGTGGG + Intronic
1030847813 7:114443054-114443076 CTGACCTACCATAAGGATGTGGG - Intronic
1031360495 7:120843783-120843805 CAGAGCTAGCAGAAGACTGTTGG + Intronic
1036692929 8:10956149-10956171 CAGTGCTGCCAGGAGGAAGTAGG + Intronic
1037823733 8:22148314-22148336 CAGATCTACCAGTGGGATGAGGG - Exonic
1039102618 8:33957452-33957474 CAGAGCTCCCAGTAGGAGTGGGG - Intergenic
1041614364 8:59888107-59888129 AAGAGCTACCTGTAAGGTGTGGG - Intergenic
1042604523 8:70532289-70532311 CACAGCTGCCCGTAGGATGCTGG - Intergenic
1045519925 8:102894676-102894698 AAGAGCTGCCAGTAGGAGGAGGG + Intronic
1046830155 8:118736608-118736630 AATAGCTACAGGTAGGATGTTGG + Intergenic
1047587425 8:126288716-126288738 CACACCTACCAGTTGGATATAGG + Intergenic
1051957214 9:22710979-22711001 TAGAGCTTCCAGTACAATGTAGG + Intergenic
1052313565 9:27093519-27093541 CAGACCAATCAGCAGGATGTGGG + Intergenic
1055011168 9:71567051-71567073 CAGATCTACCAGCAGTAGGTGGG + Intergenic
1056134514 9:83618837-83618859 CAGAGATAGAAGGAGGATGTGGG - Intergenic
1060723685 9:125994203-125994225 CAGAGCTAAGAGCAGGATGGAGG - Intergenic
1061846131 9:133389436-133389458 CAGAGCAGCCAGCAGGATGGTGG - Intronic
1062415656 9:136448317-136448339 CAGAGACACCAGGAGGATGGAGG + Intronic
1062415665 9:136448355-136448377 CAGAGACACCAGGAGGATGGAGG + Intronic
1062415676 9:136448392-136448414 CAGAGACACCAGGAGGATGGAGG + Intronic
1062415687 9:136448429-136448451 CAGAGACACCAGGAGGATGGAGG + Intronic
1062415695 9:136448466-136448488 CAGAGACACCAGGAGGATGGAGG + Intronic
1062415706 9:136448504-136448526 CAGAGACACCAGGAGGATGGAGG + Intronic
1062415740 9:136448650-136448672 CAGAGACACCAGGAGGATGGAGG + Intronic
1062415758 9:136448724-136448746 CAGAGACACCAGGAGGATGGAGG + Intronic
1062415769 9:136448762-136448784 CAGAGACACCAGGAGGATGGAGG + Intronic
1062415778 9:136448800-136448822 CAGAGACACCAGGAGGATGGAGG + Intronic
1062415786 9:136448836-136448858 CAGAGACACCAGGAGGATGGAGG + Intronic
1202794069 9_KI270719v1_random:104901-104923 CAGGGCTAACTCTAGGATGTGGG - Intergenic
1186820125 X:13279554-13279576 CAGAGCCACCATGAGGATCTGGG + Intergenic
1191179929 X:57551130-57551152 CCCAGCTACCAGGAGGATGGAGG + Intergenic
1193149128 X:78106261-78106283 CAGAGCTAGGAGTAGAATTTAGG + Intronic
1196006540 X:110843316-110843338 CAGAGGAAACAGTAGGAAGTGGG - Intergenic
1198301669 X:135339513-135339535 CAGAGCTACCAGTAGGATGTGGG + Intronic
1198416107 X:136421408-136421430 TAGACCAATCAGTAGGATGTGGG + Intergenic
1198610209 X:138390814-138390836 CAGAACTATCAGTTGGATGAAGG + Intergenic
1200748336 Y:6922331-6922353 CGGACCAATCAGTAGGATGTGGG - Intronic