ID: 1198304061

View in Genome Browser
Species Human (GRCh38)
Location X:135363148-135363170
Sequence TTAATTAGTGCAAGTGAAGC AGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 134
Summary {0: 1, 1: 0, 2: 0, 3: 9, 4: 124}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1198304061_1198304065 27 Left 1198304061 X:135363148-135363170 CCTGCTTCACTTGCACTAATTAA 0: 1
1: 0
2: 0
3: 9
4: 124
Right 1198304065 X:135363198-135363220 CTGAACAGTGGCAACAAGCATGG 0: 1
1: 0
2: 1
3: 12
4: 177
1198304061_1198304062 15 Left 1198304061 X:135363148-135363170 CCTGCTTCACTTGCACTAATTAA 0: 1
1: 0
2: 0
3: 9
4: 124
Right 1198304062 X:135363186-135363208 AGAGCTTCTTCCCTGAACAGTGG 0: 1
1: 0
2: 1
3: 16
4: 156

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1198304061 Original CRISPR TTAATTAGTGCAAGTGAAGC AGG (reversed) Exonic
902070047 1:13726566-13726588 TTAATTGGGGGAAGAGAAGCGGG + Intronic
902786622 1:18736810-18736832 TAAATTAGTTCAAGTGAAATCGG + Intronic
904218878 1:28948211-28948233 TGGATTATTGAAAGTGAAGCAGG + Intronic
905067544 1:35196044-35196066 TTAAATAGTGCCAGTCAAGTGGG - Intergenic
909918646 1:81352886-81352908 TTAATTAGGTCAGGTCAAGCAGG + Intronic
910466848 1:87509315-87509337 TTAATCAGGGCAAGTGGAGTAGG + Intergenic
911785941 1:101947936-101947958 TTATTTAGTGAAAGGGAAGGTGG + Intronic
913573608 1:120146265-120146287 TCAAATAGTTCAAGTGAAGTAGG + Intergenic
914294867 1:146311065-146311087 TCAAATAGTTCAAGTGAAGTAGG + Intergenic
914555908 1:148761848-148761870 TCAAATAGTTCAAGTGAAGTAGG + Intergenic
916634485 1:166653622-166653644 TTAATCAATTCAAGTGTAGCAGG + Intergenic
920323352 1:205141713-205141735 TCATTTAATGCAACTGAAGCCGG - Intergenic
920987953 1:210908343-210908365 TTAACAAGTGGAAGGGAAGCAGG - Intronic
1066352665 10:34651149-34651171 TAATTTTGTGAAAGTGAAGCTGG - Intronic
1067321408 10:45224403-45224425 TTATTTAGTGCAGGTGTAGCAGG - Intergenic
1068474858 10:57511705-57511727 TTAGTTTGTGCATTTGAAGCTGG + Intergenic
1068872579 10:61961247-61961269 TTAATTATAGCAAGTGATACAGG - Intronic
1076841218 10:133046578-133046600 TTAATTAGTGCACATTTAGCTGG - Intergenic
1080252786 11:30253987-30254009 TAAATGAGTGCAAGTGAAACTGG + Intergenic
1082174693 11:49047440-49047462 TTAATTAGATTAAGTGATGCTGG - Intergenic
1082235676 11:49818738-49818760 TTAATTAGATTAAGTGATGCCGG + Intergenic
1082239142 11:49853322-49853344 TTAATTAGATTAAGTGATGCTGG + Intergenic
1082609181 11:55278685-55278707 TTAATTAGATTAAGTGATGCCGG + Intergenic
1082657510 11:55871849-55871871 TTAATTAGATTAAGTGATGCCGG - Intergenic
1082733240 11:56825694-56825716 TTAATGACGGAAAGTGAAGCAGG + Intergenic
1082988846 11:59190082-59190104 TTAATTCTTACAAGAGAAGCAGG + Intronic
1083934539 11:65863402-65863424 CCACTTAGTGCCAGTGAAGCAGG + Exonic
1085193110 11:74646284-74646306 TTTATAAGTGAAAGTGCAGCTGG + Intronic
1085585799 11:77704569-77704591 TAAATTAGTGTTAGTGAACCTGG - Intronic
1086691085 11:89788647-89788669 TTAATTAGATTAAGTGATGCTGG + Intergenic
1086714717 11:90051008-90051030 TTAATTAGATTAAGTGATGCTGG - Intergenic
1088644522 11:111906776-111906798 TTGATTAGTCCAAATCAAGCAGG - Intergenic
1091474713 12:761189-761211 TAAATTAATGTAAGTGAAGGTGG - Intronic
1091979206 12:4851980-4852002 TTATTTACTACAAGTGAAGGTGG + Intergenic
1095378664 12:41562228-41562250 GTATTTAGTGCAAGGAAAGCAGG - Intronic
1097614213 12:61864028-61864050 AGAATGAGAGCAAGTGAAGCAGG - Intronic
1097855583 12:64458260-64458282 TTAAATAGTTAAAGGGAAGCAGG - Intronic
1098800220 12:74947788-74947810 TTAATTAGTGAAATTGAATTTGG + Intergenic
1098845666 12:75532633-75532655 TTTATTAGTGGAAATGAGGCAGG + Intergenic
1100814765 12:98375607-98375629 TTAATTAATTCAACTGAAACTGG + Intergenic
1100906161 12:99301932-99301954 ATAATTTGTTCAAGTGAAGTGGG + Intronic
1102384728 12:112498939-112498961 ATAATTAGTACAAATGAAACAGG - Intronic
1106204325 13:27575752-27575774 TTCATTAGTGAAAATGAAGCTGG + Intronic
1108047220 13:46394681-46394703 ATAATTGATGCAAGAGAAGCTGG - Intronic
1110158900 13:72352213-72352235 TTTATTACTGCTATTGAAGCAGG + Intergenic
1111176977 13:84607669-84607691 TTAGTTAGGGCAACTAAAGCAGG + Intergenic
1113615475 13:111677421-111677443 ATAATTAGTGATGGTGAAGCAGG - Intergenic
1113620943 13:111762327-111762349 ATAATTAGTGATGGTGAAGCAGG - Intergenic
1114356144 14:21911138-21911160 TTGTTTAGGGCAAGTGAAGCGGG + Intergenic
1114574393 14:23699372-23699394 TAAATTGGTGCCAATGAAGCAGG + Intergenic
1115257426 14:31417907-31417929 TTAATAAGTAAAAGTGAGGCTGG + Intronic
1120852322 14:89182467-89182489 TTAATTAGGGTAAGTGACGGGGG - Intronic
1122682157 14:103473330-103473352 CAAATTAGTGCAAGTAAAACTGG + Intronic
1126194674 15:45918749-45918771 TTAAGTAGTTCAAGTGAAGTTGG - Intergenic
1132607390 16:799304-799326 TTAATTAGTCCCAGTGCAGGAGG - Intronic
1139036679 16:62955827-62955849 TTAATTAATTCAAGTCCAGCAGG - Intergenic
1149164678 17:53737011-53737033 TTAATTAAAGCCAGCGAAGCAGG - Intergenic
1149558803 17:57593703-57593725 CTAATTAGGACAAGTGTAGCAGG - Intronic
1155614926 18:27711065-27711087 TTAAGTTGTGAAAATGAAGCTGG - Intergenic
1156391805 18:36657970-36657992 TTAATTTTTGCAAGAGAAACAGG - Intronic
1158339140 18:56446626-56446648 TTATTTATTGCAAGTGATACTGG - Intergenic
928280954 2:29945772-29945794 TTAAACAGTGGAATTGAAGCAGG - Intergenic
928840981 2:35604344-35604366 TTATATGGTGCAAGTTAAGCTGG + Intergenic
930304816 2:49665198-49665220 TTCATTAGTCCAAGTATAGCGGG + Intergenic
932835303 2:75030624-75030646 ATAATAAGTGCTAGGGAAGCTGG + Intergenic
934588793 2:95528029-95528051 TTAATTAGATTAAGTGATGCCGG + Intergenic
937964004 2:127487313-127487335 TAAATGAGTGCAAGTAAAACTGG - Intronic
938962594 2:136356632-136356654 TTTATTAGTGGCAGTGGAGCTGG + Intergenic
941215777 2:162706910-162706932 TTAATGAGTACAATTGGAGCGGG + Intronic
942039660 2:172046568-172046590 TTAATTAGAGGAAGTGGAGGTGG + Intronic
944132836 2:196365196-196365218 ATATTTATTGCAAGTAAAGCAGG + Intronic
946377606 2:219322359-219322381 ATATTTAGTGCAGGTGAGGCAGG - Intergenic
1169755812 20:9042101-9042123 TTAATTACCATAAGTGAAGCTGG + Intergenic
1174026156 20:47577617-47577639 TTAATTAGGAAAAGGGAAGCAGG - Intronic
1174672839 20:52323978-52324000 TTAGTAAGTCCACGTGAAGCAGG + Intergenic
1178551618 21:33543820-33543842 TTAATTACAGCAAGTGAAAGTGG + Intronic
1183447231 22:37865817-37865839 TGACTTAGAGCAAGTGAAGAAGG + Intronic
950794881 3:15502708-15502730 TTCATCAGTGCAAGTTAGGCCGG - Intronic
951044747 3:18025275-18025297 TTAATTATTTCAAGGGAATCTGG + Intronic
951854094 3:27175538-27175560 TTAATTAATGCCACTGATGCTGG + Intronic
956570174 3:70685704-70685726 TTAATTTCTGCAAGTGAAGTAGG + Intergenic
959384159 3:105681081-105681103 TTAATTAGCGTAAGTGGAACTGG + Intronic
959815549 3:110669952-110669974 TAAATTAGTACAAGTAAAGTGGG + Intergenic
961981071 3:131079457-131079479 TTCATTAGGGCAAGTGCTGCAGG - Intronic
962545274 3:136428170-136428192 CTCATTTGTGCAAATGAAGCTGG + Intronic
963079925 3:141381723-141381745 ACAATTACTGCAAATGAAGCAGG + Intronic
963503527 3:146158207-146158229 TTAATCAGTGCCAGTAAATCAGG - Intronic
963632917 3:147756155-147756177 TTAATTAGTGCTATTGTTGCTGG - Intergenic
966262433 3:177994987-177995009 TTAATTGGTTCAATTGAAGTTGG - Intergenic
967327780 3:188259332-188259354 TTAATTAGAGCAAGAGAGACTGG - Intronic
970567314 4:17345088-17345110 TGAATTAGTGAAAGTCATGCAGG - Intergenic
974678352 4:65126699-65126721 TTAATTAGAGCATCTGAATCAGG + Intergenic
977239677 4:94552925-94552947 TTGATTAGTGCATCTGAAGCAGG + Intronic
980797666 4:137705757-137705779 TTTATTACTGCAAGTGTAACCGG - Intergenic
982133194 4:152248288-152248310 TCAATCAGTGCAGGTGAAGGCGG + Intergenic
984840959 4:184066966-184066988 TAAATCATTGCAAGTGAAGAGGG - Intergenic
987887592 5:23831498-23831520 TTCATTAGTCCAAGGGTAGCAGG - Intergenic
989266798 5:39484170-39484192 ATAACTAGTGCAATTGAAACTGG + Intergenic
990631716 5:57677611-57677633 TTAAATAGGACAAGTGAGGCTGG + Intergenic
992561711 5:77958462-77958484 TTAAATATTGCTAATGAAGCCGG - Intergenic
993413648 5:87600765-87600787 TTCATTAGTCCAAGGGTAGCAGG + Intergenic
993802742 5:92363973-92363995 ATATTTAATGCAAGTGAATCAGG - Intergenic
995462231 5:112416282-112416304 TTAATTATAGCAAGTTAAGGTGG - Intronic
1005958793 6:30682429-30682451 TTATTTAGGGAAGGTGAAGCGGG + Intronic
1008423310 6:51328269-51328291 CTAGTTAGTGCCAGTGAAGGTGG + Intergenic
1010898009 6:81390093-81390115 TAAATTAGTACATATGAAGCTGG - Intergenic
1014439674 6:121459965-121459987 TTAATAAATGCAGTTGAAGCAGG + Intergenic
1014711589 6:124812607-124812629 CTAATTAGTGCAAGGGAAATTGG - Intronic
1017250266 6:152272723-152272745 TTACTTAGTGCTACTGAAGCTGG - Intronic
1021033306 7:15765450-15765472 CTAATTAGTGCAAGTGACTATGG - Intergenic
1021397588 7:20169292-20169314 TTAATTATTGCAAGAGTAGTTGG + Intronic
1022198642 7:28094709-28094731 TGAATAAGTGGAGGTGAAGCAGG - Intronic
1026689624 7:72540451-72540473 TTAGAAAGTGCAAGTGAGGCCGG + Intergenic
1030769235 7:113453506-113453528 TTCATTTGTGCAAATGAAGAAGG + Intergenic
1037408376 8:18567969-18567991 TTTATTAGTTCAAGTGAAAGTGG + Intronic
1041798689 8:61774214-61774236 TTAGTTGGTAGAAGTGAAGCAGG - Intergenic
1041988986 8:63962358-63962380 TTAAATATTGCAAGTCAAGTTGG - Intergenic
1042438725 8:68799512-68799534 TTAATTTGAGGAGGTGAAGCAGG - Intronic
1042836967 8:73087767-73087789 ATAATTAACCCAAGTGAAGCAGG - Intronic
1043076477 8:75707691-75707713 TTAAATAGTACATGTGAAGTGGG + Intergenic
1044460966 8:92443497-92443519 TAAATTAGTGGGAGTGAGGCTGG + Intergenic
1047132527 8:122037085-122037107 TAAATCATTGCAAGTGGAGCTGG + Intergenic
1049764202 8:144345889-144345911 TTAATTAGCTCAAGTGATGGTGG + Intergenic
1050881616 9:10707014-10707036 GTAACCAGAGCAAGTGAAGCAGG + Intergenic
1051295051 9:15586781-15586803 TTAATTAATTAAAGGGAAGCTGG - Intronic
1052507178 9:29370866-29370888 GTAACTATTTCAAGTGAAGCAGG + Intergenic
1055541535 9:77311217-77311239 TTAATTAGTGAAAGTGGGCCAGG - Intronic
1056343886 9:85670446-85670468 TTAATTAAAGCAAGTGTAGCAGG + Intronic
1060195402 9:121620372-121620394 TTAACCACTGCAAGTGGAGCAGG - Intronic
1061654517 9:132078911-132078933 TTAAAAAGTGTAAGTGAAGAAGG + Intronic
1187057601 X:15755825-15755847 TTAAAAAGTGCAAGTTAAACAGG + Intronic
1196123895 X:112079800-112079822 TGAATTAGTATCAGTGAAGCCGG + Intronic
1198304061 X:135363148-135363170 TTAATTAGTGCAAGTGAAGCAGG - Exonic
1201292624 Y:12436274-12436296 TTCATTATTGCCAGTGAAGTGGG - Intergenic