ID: 1198310242

View in Genome Browser
Species Human (GRCh38)
Location X:135422553-135422575
Sequence CGGTCTCAGCCCGGGGGCCC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 226
Summary {0: 1, 1: 1, 2: 0, 3: 22, 4: 202}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1198310224_1198310242 20 Left 1198310224 X:135422510-135422532 CCTACGCCGCCAGGGCACGACGG 0: 1
1: 0
2: 1
3: 1
4: 30
Right 1198310242 X:135422553-135422575 CGGTCTCAGCCCGGGGGCCCTGG 0: 1
1: 1
2: 0
3: 22
4: 202
1198310233_1198310242 -8 Left 1198310233 X:135422538-135422560 CCCTGGCCCCGGCTGCGGTCTCA 0: 1
1: 0
2: 2
3: 16
4: 182
Right 1198310242 X:135422553-135422575 CGGTCTCAGCCCGGGGGCCCTGG 0: 1
1: 1
2: 0
3: 22
4: 202
1198310232_1198310242 -4 Left 1198310232 X:135422534-135422556 CCAGCCCTGGCCCCGGCTGCGGT 0: 1
1: 1
2: 3
3: 59
4: 584
Right 1198310242 X:135422553-135422575 CGGTCTCAGCCCGGGGGCCCTGG 0: 1
1: 1
2: 0
3: 22
4: 202
1198310227_1198310242 11 Left 1198310227 X:135422519-135422541 CCAGGGCACGACGGCCCAGCCCT 0: 1
1: 1
2: 0
3: 22
4: 217
Right 1198310242 X:135422553-135422575 CGGTCTCAGCCCGGGGGCCCTGG 0: 1
1: 1
2: 0
3: 22
4: 202
1198310226_1198310242 14 Left 1198310226 X:135422516-135422538 CCGCCAGGGCACGACGGCCCAGC 0: 1
1: 0
2: 1
3: 9
4: 132
Right 1198310242 X:135422553-135422575 CGGTCTCAGCCCGGGGGCCCTGG 0: 1
1: 1
2: 0
3: 22
4: 202
1198310234_1198310242 -9 Left 1198310234 X:135422539-135422561 CCTGGCCCCGGCTGCGGTCTCAG 0: 1
1: 0
2: 2
3: 22
4: 313
Right 1198310242 X:135422553-135422575 CGGTCTCAGCCCGGGGGCCCTGG 0: 1
1: 1
2: 0
3: 22
4: 202
1198310230_1198310242 -3 Left 1198310230 X:135422533-135422555 CCCAGCCCTGGCCCCGGCTGCGG 0: 1
1: 1
2: 5
3: 84
4: 754
Right 1198310242 X:135422553-135422575 CGGTCTCAGCCCGGGGGCCCTGG 0: 1
1: 1
2: 0
3: 22
4: 202

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1198310242 Original CRISPR CGGTCTCAGCCCGGGGGCCC TGG Intergenic
900100371 1:959888-959910 CTGTCCAGGCCCGGGGGCCCGGG - Intergenic
900292568 1:1929751-1929773 CAGTCTCAACCTGGGAGCCCTGG + Intronic
900366732 1:2314708-2314730 CGTTCCCAGTCCGGGGGCACTGG + Intergenic
901664115 1:10816828-10816850 CGGTCTGAGGCCGGGGGCCTGGG + Intergenic
902830500 1:19009312-19009334 GGCTCTCAGCCCAGGGTCCCGGG - Intergenic
903138136 1:21322550-21322572 TGGTCACAGGCCTGGGGCCCTGG - Intronic
904256586 1:29258629-29258651 CGGGCACAGCCCGGGCACCCTGG + Exonic
912879124 1:113390950-113390972 CCGTCTCAGCCCGGGGGCCCTGG - Exonic
914203545 1:145506797-145506819 AGGTCACAGCCCAGGGGCACAGG - Intergenic
914482667 1:148079951-148079973 AGGTCACAGCCCAGGGGCACAGG - Intergenic
915238582 1:154502931-154502953 CCCTCTGAGCCCGGGGGCACGGG - Intronic
915949804 1:160181583-160181605 CTGACTCAGCCCAGGGGTCCTGG + Intronic
918423400 1:184386465-184386487 CGGGCGCAGCCCAGAGGCCCGGG - Intergenic
918649698 1:186946068-186946090 CTGTCTAAGCGCGGGGGCTCTGG - Intronic
921010378 1:211134477-211134499 CTGTTTCAGGCCGGGGCCCCCGG + Intergenic
923506154 1:234608643-234608665 CGCGCTCAGCTCGGCGGCCCCGG + Exonic
923650187 1:235866704-235866726 CGCCCTCAGCCCGGCGGTCCCGG + Intronic
1066046899 10:31602905-31602927 CCGGCTCAGCCTGGGAGCCCAGG - Intergenic
1069615063 10:69801725-69801747 CGGCCCCAGCCCGCCGGCCCGGG - Intergenic
1070707916 10:78655052-78655074 TGGGCTCAGCCAAGGGGCCCTGG - Intergenic
1073060369 10:100730114-100730136 CGGCCTCAGCGCGAGAGCCCTGG + Intergenic
1074169754 10:110920062-110920084 CGGACTGGGCCCGGGGGCCCAGG - Intronic
1075686023 10:124365710-124365732 CGTGCTGAGGCCGGGGGCCCTGG - Intergenic
1076737683 10:132466077-132466099 CGGCCTCAACCTGCGGGCCCGGG - Intergenic
1076920053 10:133446517-133446539 CGTCCTGGGCCCGGGGGCCCCGG + Intergenic
1076989071 11:260134-260156 CGGTCTCACCCAGGTGGCCGAGG - Intergenic
1077078250 11:710875-710897 CGGGCTCAGCCACGGGGCCGGGG + Intronic
1077225618 11:1437930-1437952 TGGTGTCAGCCCGGCGGCCTGGG + Intronic
1082986086 11:59172383-59172405 CGGTCCCAGCCAGGCGGCCCCGG + Intronic
1083618440 11:64037316-64037338 CTGTCTCTGCCCGGCGGCCGCGG + Intronic
1085353543 11:75815786-75815808 CGGCCTCGGGCCGGGGCCCCAGG - Intronic
1087890921 11:103537141-103537163 CTGTCTCAGCCCGGGTGAGCTGG + Intergenic
1090306264 11:125693720-125693742 CTGTCTCAGCCCAGGGCCACAGG - Intergenic
1092229012 12:6766650-6766672 CCGTCTCGGCCCCGGGACCCCGG + Exonic
1094672638 12:32585806-32585828 AGGTCTCAGCTCTGTGGCCCAGG - Intronic
1096476660 12:51913041-51913063 CGGGCTCAGCCTGGGGGAGCTGG + Intronic
1096750736 12:53757232-53757254 CGGGCTCAGCCCGGTTGCCAGGG + Intergenic
1102766808 12:115440567-115440589 ATGTGTCAGCTCGGGGGCCCAGG - Intergenic
1102997380 12:117360959-117360981 CGGCCTCAGGCCGGGGGCTCCGG - Intronic
1103942122 12:124506839-124506861 CCGTCACAGCCCAGGGGCACGGG - Intronic
1104811126 12:131621041-131621063 TGGCCTCAGCCCTGGGGCTCTGG - Intergenic
1104858262 12:131911974-131911996 CGGTGTCAGCCGGGGAGGCCAGG - Exonic
1104946367 12:132416647-132416669 GGGTCTCAGGCTGGGGGCACTGG - Intergenic
1107980132 13:45727371-45727393 AGGTCACAGCCCAGGGGCACAGG - Intergenic
1110318253 13:74134492-74134514 CGGACCCAGCCCGGCGGTCCGGG - Intergenic
1113672492 13:112184477-112184499 CGGCCTGAGCCTGGGGGCCTGGG - Intergenic
1119379771 14:74221127-74221149 GGGTCTGAGCCCCGGGGCTCAGG + Intergenic
1119383233 14:74241414-74241436 CGGAATCTGCCCGGGGGCCTTGG + Intronic
1120070871 14:80100783-80100805 TGCTCTCAGCCCTGGGGCCCTGG + Intergenic
1121127608 14:91417965-91417987 CGGTGCCAGCCCGGGAGCCCGGG + Intergenic
1121137378 14:91510623-91510645 CGGCCTCTGCCCGCGGGCCCCGG + Intergenic
1122060246 14:99132288-99132310 CGGTCTAACCCCGGGGGAGCTGG + Intergenic
1122115149 14:99523778-99523800 GGGTCTCAGCACGGGGGCCTTGG + Intronic
1122266840 14:100550596-100550618 CGGTCTCAGCCAAGGGGCTGTGG - Intronic
1123000933 14:105293720-105293742 CAGTCTCTGCTCGGGTGCCCCGG + Intronic
1123473590 15:20571769-20571791 CGGTCCCAGCCCCAGGGCCTGGG + Intergenic
1123644419 15:22428584-22428606 CGGTCCCAGCCCCAGGGCCTGGG - Intergenic
1123733888 15:23166780-23166802 CGGTCCCAGCCCCAGGGCCTGGG + Intergenic
1123906804 15:24929612-24929634 GGGTCTCAGCCCAGGGCCCTGGG - Intronic
1124583570 15:30984798-30984820 CAGCCTCAGCACAGGGGCCCAGG + Intronic
1125518385 15:40335424-40335446 CGGTCTGAGGCCTGGGGCCCAGG - Exonic
1125720125 15:41841355-41841377 CTGCCTCAGCCTGGGGACCCTGG + Intronic
1125734709 15:41916692-41916714 CGGACTCAGCACGGCGGCCTTGG - Intronic
1128338916 15:66806247-66806269 GGGTCACAGCCCAGGGGCTCAGG + Intergenic
1129704286 15:77785579-77785601 AGGTCCCAGCCCTGGAGCCCTGG - Intronic
1130546095 15:84858307-84858329 CGGTTTCCCCCCGGGGGCCCAGG + Exonic
1132409077 15:101562900-101562922 CGGGCTCATCCTGGGGGCCTGGG - Intergenic
1132544778 16:528066-528088 CGCTCCCCGCCCGGGGTCCCCGG - Intronic
1132576909 16:668443-668465 CGGGCCCAGCCGGGGGTCCCTGG + Intronic
1132905954 16:2282945-2282967 AGGAGTCAGCCTGGGGGCCCAGG - Intronic
1137984186 16:53093997-53094019 CGGTGTCAGCCTTGGGGGCCTGG + Intronic
1138105624 16:54285951-54285973 CGGCGGCAGCGCGGGGGCCCGGG - Exonic
1138106019 16:54287412-54287434 GGGTGGCAGCCCGGGGGCACTGG + Intergenic
1139599492 16:67978054-67978076 CCATCACAGCCTGGGGGCCCTGG + Intronic
1139661505 16:68424077-68424099 CAGTCTTAGCCAGGGGGCCTAGG + Intronic
1141636731 16:85317897-85317919 CTGCCTCAGCCCGGGGTTCCTGG + Intergenic
1142132223 16:88436328-88436350 CAGGCTGAGGCCGGGGGCCCAGG - Exonic
1142132230 16:88436338-88436360 CGGCCTCAGCCTGTGGGCCCTGG + Exonic
1142156466 16:88534715-88534737 CGGCCTCGGCCCGGAGCCCCAGG + Exonic
1142291974 16:89197344-89197366 CGGACACAGCCCGGGAGGCCAGG + Exonic
1142384004 16:89750916-89750938 CAGTCTCAGTCCGGTTGCCCAGG + Intronic
1142474271 17:180410-180432 CCCTCTCTGCCCGGGGGCCGCGG + Intronic
1142799631 17:2337279-2337301 CGCTCTCAGCCGCGGGGCCGCGG + Exonic
1143405490 17:6674801-6674823 CTGGCTCAGCCCCGAGGCCCAGG - Intergenic
1143512875 17:7405588-7405610 CTGGCTCAGCCCTGGGGCCGTGG - Intronic
1144807515 17:17977670-17977692 CGGCCTCCTCCTGGGGGCCCTGG - Exonic
1145110357 17:20156460-20156482 CGGTGCCTGCCCGGCGGCCCCGG - Intronic
1145269276 17:21396083-21396105 CTGCCTGCGCCCGGGGGCCCAGG - Intronic
1146132682 17:30292117-30292139 CGGCCTCAGCCCCCGGGCGCTGG - Intergenic
1147467129 17:40619100-40619122 TGGACTCTGCCCTGGGGCCCCGG + Intergenic
1152290129 17:79435643-79435665 CGGGCTCAGGCCCGGGCCCCTGG + Intronic
1152720667 17:81922438-81922460 GGGGCTCAGCCCGGCGCCCCTGG + Exonic
1152743887 17:82030535-82030557 CGGCCTCAGCACGGGAGACCTGG - Intronic
1152745584 17:82037236-82037258 CTTTCTGAGCCCGGGGGCCCCGG + Intronic
1152906874 17:82975039-82975061 CGGGCTCTGTCCTGGGGCCCTGG - Intronic
1153223394 18:2880722-2880744 TGCTCACAGCCCGGGGCCCCTGG + Intronic
1153263632 18:3247320-3247342 GGGTCTCCGCCTGAGGGCCCCGG - Intergenic
1154501016 18:14998112-14998134 CGGCACCAGCGCGGGGGCCCCGG + Intergenic
1156982308 18:43305115-43305137 AGGTGTCAGCTCTGGGGCCCTGG - Intergenic
1160700886 19:506795-506817 AGGTGCCAGCCCGGGGGCCCTGG + Intergenic
1161506195 19:4645004-4645026 TGCACTCAGTCCGGGGGCCCAGG - Intronic
1162502244 19:11060475-11060497 CGGCCTCAGCCCAGGAGCCCTGG - Intronic
1162722493 19:12670621-12670643 GGGCCTAAGCACGGGGGCCCAGG + Exonic
1163111107 19:15161342-15161364 AGCTGTCAGCCAGGGGGCCCGGG + Exonic
1163470926 19:17496547-17496569 CAGGCTCAGCCAGGGGGCTCTGG + Intronic
1163601220 19:18250270-18250292 GGGGCTCAGCCCTGGGGCCAAGG - Intronic
1163846303 19:19640126-19640148 CGATCTCAGCCTGGGAACCCTGG - Exonic
1164594885 19:29526256-29526278 CAGTCTCTGCCCGGCGGGCCGGG - Intergenic
1164686013 19:30167342-30167364 AGGGCCCAGCCCGGGGGACCAGG - Intergenic
1165149432 19:33752143-33752165 CTGCCTGAGCCCGGGAGCCCTGG + Intronic
1165813430 19:38626279-38626301 CGGCCTCAGCCTGTGGGCACGGG - Intronic
1166304511 19:41929831-41929853 CGGTCTCAGCACCTGGGCGCTGG - Intronic
1166317942 19:41999055-41999077 CGGGCTCCGCTGGGGGGCCCCGG + Exonic
1167071890 19:47226656-47226678 CGGTCCCACCCAGGCGGCCCCGG - Exonic
1167458128 19:49609277-49609299 CGGTCTCACTCCGGTTGCCCAGG - Intronic
1167662749 19:50805289-50805311 CGGTCTAAGGCCTGGGGGCCTGG + Intergenic
1168292390 19:55362883-55362905 CCCTCTCAGCCCCGGGGCACTGG + Intronic
925055227 2:852084-852106 CGGCCTCTGCCCAGGGCCCCAGG - Intergenic
927696439 2:25242634-25242656 CAGTCTCAACCCAGGGACCCTGG - Intronic
927794301 2:26034506-26034528 CGTTCTCAGGCCGGAGGACCGGG - Exonic
927990297 2:27442576-27442598 CAGACGCCGCCCGGGGGCCCAGG + Exonic
929786967 2:45000416-45000438 GGGTGTCGGCCTGGGGGCCCTGG + Intergenic
931598583 2:63978097-63978119 AGGTCGCAGCCCAGGGGCACAGG - Intronic
932191074 2:69741980-69742002 CCGTCCCGGCCCGGGGCCCCAGG + Exonic
934491208 2:94762929-94762951 AGGTCTCAGCCCAGGCTCCCTGG - Intergenic
938210115 2:129459998-129460020 CAGTCTCAGCTGGAGGGCCCAGG - Intergenic
938302842 2:130228694-130228716 CTGTCCAGGCCCGGGGGCCCGGG + Intergenic
938453827 2:131445528-131445550 CTGTCCAGGCCCGGGGGCCCGGG - Intergenic
938500187 2:131828301-131828323 CGGCACCAGCGCGGGGGCCCCGG + Intergenic
942799808 2:179861710-179861732 GGTCCTCAGCCCGGGGGCTCGGG + Intergenic
944807765 2:203299007-203299029 AGGTCTCAGCCCTGTCGCCCAGG - Intronic
946277589 2:218643012-218643034 CAGCCCCAGCCCGTGGGCCCCGG - Exonic
946327834 2:218993755-218993777 CGGTCTTAGCCCGAGGCCCAGGG - Intergenic
946402799 2:219477345-219477367 GGTGCTCAGCACGGGGGCCCAGG + Exonic
947751274 2:232533984-232534006 TGGACCCAGCCCTGGGGCCCTGG + Exonic
948062488 2:235052026-235052048 AGGTCTCAGTCAGGGGTCCCAGG + Intronic
948585388 2:239015817-239015839 GGGGCTCAGCCCGCTGGCCCTGG - Intergenic
949027137 2:241771700-241771722 TGGCCTCAGCTCAGGGGCCCTGG - Intergenic
1170349798 20:15426368-15426390 CGGTCTCACTCCTGTGGCCCAGG + Intronic
1172106770 20:32521805-32521827 CAGTCTCAGCCCAGGGAACCTGG - Intronic
1172293391 20:33791568-33791590 CGGTCTGCCCCCAGGGGCCCTGG - Exonic
1172703039 20:36864009-36864031 CGGCCTCGGCCCGGGAGTCCCGG - Intergenic
1174110380 20:48194326-48194348 GGGTCTCAGCAGAGGGGCCCAGG + Intergenic
1174171409 20:48620186-48620208 GGGTCTCAGCAGAGGGGCCCAGG - Intergenic
1175264650 20:57695335-57695357 CAGCCCCAGCCAGGGGGCCCAGG - Intronic
1175305941 20:57975620-57975642 CTGTCCCAGCCAGGGGGCCTGGG - Intergenic
1175892135 20:62320630-62320652 CCGTCTCATGGCGGGGGCCCAGG + Exonic
1178457734 21:32771443-32771465 CGGCCTCAGCCCCGAGGCCCGGG + Exonic
1180062529 21:45393029-45393051 AGGACTCAGCCATGGGGCCCAGG - Intergenic
1181106519 22:20579018-20579040 AGTGCTCAGCACGGGGGCCCAGG + Intronic
1181573668 22:23781052-23781074 CTATCCCAGCCTGGGGGCCCAGG - Exonic
1182279530 22:29209700-29209722 GGGTCTCAGCCCTCAGGCCCAGG - Intronic
1183290966 22:37001941-37001963 CGGTCCCAGCTTGGGGGCTCAGG - Exonic
1183384762 22:37508648-37508670 CGCTCGGAGCCCGGGGCCCCCGG + Exonic
1184608302 22:45586810-45586832 TGGAGTCAGCCCGAGGGCCCAGG + Intronic
1185319102 22:50192347-50192369 GGAGCTCAGGCCGGGGGCCCAGG - Intronic
1185351643 22:50342859-50342881 CGGGCTCAGCCCCGGGCGCCAGG - Intergenic
1185402250 22:50625231-50625253 CGGCCCCAGCCAGGTGGCCCGGG - Exonic
949480897 3:4493206-4493228 AGGGCCCAGCCCGGGCGCCCAGG + Intergenic
955147004 3:56329655-56329677 AGGTCACAGCCCAGGGGCACAGG + Intronic
960582743 3:119294678-119294700 CGGCCTCGGCACGGCGGCCCCGG + Exonic
962209677 3:133466920-133466942 CTGTCTCAGCCTGGAGGCTCTGG - Exonic
966200949 3:177359323-177359345 CTGTCGCAGCCTGGGGGCACTGG - Intergenic
968453189 4:684613-684635 GCGTCTCAGCCCCGGAGCCCGGG + Intronic
968656941 4:1782788-1782810 CGGTCCCAGCCCGGAGGACCGGG - Intergenic
969471634 4:7392611-7392633 AGGTCTCCGCCTGGGGTCCCGGG + Intronic
969682225 4:8649748-8649770 CAGCCTCTGCCCGGGGCCCCCGG + Intergenic
969721178 4:8893734-8893756 CGGTCTCTGCCCAGGAGTCCAGG - Intergenic
973613556 4:52658895-52658917 CCGTCTCAGCCCCGGGACCTCGG - Intronic
978072672 4:104491754-104491776 CGGGCCGAGCCCGGAGGCCCCGG - Exonic
985537288 5:472552-472574 CGGTCTCAGGGTGGCGGCCCCGG - Intronic
985550156 5:528692-528714 AGGTCTCGGCCCAGGGGCGCGGG - Intergenic
1001684303 5:173581917-173581939 GGGCCTCAGCCCAGGAGCCCTGG + Intergenic
1002006580 5:176238919-176238941 GGGTCTCAGGCCGGGGCCGCGGG + Intronic
1002219798 5:177671717-177671739 GGGTCTCAGGCCGGGGCCGCGGG - Intergenic
1002561155 5:180083204-180083226 CTGGCTCAGCTCAGGGGCCCAGG - Intergenic
1003250112 6:4420379-4420401 GGGTCACAGCCCAGGGGCACAGG + Intergenic
1004905421 6:20233314-20233336 CGGCCTCAGCCCGCAAGCCCCGG + Intergenic
1006808627 6:36805642-36805664 CCGTCCCAGCCCTGGGGCCCAGG - Intronic
1009156230 6:59818776-59818798 GGGTCTCAGCTCTGTGGCCCAGG - Intergenic
1016329837 6:142945015-142945037 CGGCCGCAGGCCGGCGGCCCGGG + Intronic
1018869047 6:167767672-167767694 GGCTCACAGCACGGGGGCCCGGG - Intergenic
1018942633 6:168319590-168319612 CGGTCCCAGCCCGCGGACCCCGG + Exonic
1019053283 6:169201019-169201041 TGGACACAGCCCGGGAGCCCTGG + Intergenic
1019189322 6:170241963-170241985 CGGTCTCAGGCCGGGCGCGGTGG + Intergenic
1019279538 7:192947-192969 CGCCCTCAGCCGGGGAGCCCAGG - Exonic
1019563948 7:1670579-1670601 CCGACAAAGCCCGGGGGCCCGGG + Intergenic
1024587377 7:50853764-50853786 CGGTATCAGTCCAGGGGCCCTGG - Intergenic
1029640314 7:101816149-101816171 CGGCCTCCGCCGGGGGCCCCGGG + Intronic
1031972326 7:128073824-128073846 CTGTCTCATCCCGAGGACCCAGG - Intronic
1033944487 7:146699487-146699509 TGGTCACAACCCAGGGGCCCAGG - Intronic
1034463266 7:151210275-151210297 CGGCAGCAGCCCGGGGGCCGTGG - Intronic
1034467859 7:151240296-151240318 CTGCCCCAGCCCCGGGGCCCTGG - Intronic
1034500692 7:151448662-151448684 GGGGCGCAGCCAGGGGGCCCGGG - Intergenic
1035167333 7:156999772-156999794 CGGGGTCAGGCCGGGGGCCGCGG - Intronic
1035670025 8:1409861-1409883 CAGTCTAAGCCCGAAGGCCCCGG - Intergenic
1035848854 8:2894067-2894089 CGGTCTCAGACGTGGGGTCCTGG - Intergenic
1040105098 8:43537264-43537286 AGGTCTCAGCCCAGGCTCCCTGG + Intergenic
1040105250 8:43537920-43537942 AGGTCTCAGCCCAGGCTCCCTGG - Intergenic
1040467065 8:47705087-47705109 CGGTCTCAGCCAGAGGGCCGTGG - Intronic
1042392199 8:68248830-68248852 TGTTCTCAGCCCTGGGGCCACGG + Intergenic
1049036106 8:140077513-140077535 CTGCCTCAGCCCTGGGGCTCAGG - Intronic
1049109608 8:140635144-140635166 CGGCCCCAGCCCGCGGGCCCCGG + Intronic
1049158008 8:141078665-141078687 CGGGCTCAACCCTGGGGCCGTGG - Intergenic
1049310793 8:141932806-141932828 CCTGCTCAGCCTGGGGGCCCTGG - Intergenic
1049435171 8:142583198-142583220 AGGCCTCAGCCCAGTGGCCCAGG - Intergenic
1049623581 8:143610046-143610068 CGGTCTCAGGCCCCTGGCCCTGG - Intergenic
1049789454 8:144466162-144466184 CGCTCTCAGCCCGGTGTCCGCGG + Exonic
1049916640 9:324148-324170 AGGTCTCTGCCTGGGTGCCCTGG + Intronic
1052880554 9:33598940-33598962 AGGTCTCAGCCCAGGCTCCCTGG + Intergenic
1054798624 9:69325367-69325389 GGGCCGCAGGCCGGGGGCCCGGG + Intronic
1060968483 9:127724669-127724691 CGGCTCCAGCCCGGGGGCCAGGG - Intronic
1062268202 9:135696935-135696957 CAGCCTCTGCCCAGGGGCCCTGG + Intronic
1062279541 9:135745807-135745829 GGGTCTCAGCCCTGGGCCTCTGG + Intronic
1062499521 9:136846276-136846298 CGGCGCCAGCGCGGGGGCCCCGG - Exonic
1062507589 9:136886116-136886138 GGGTCTCCGCCCCGGGGCCACGG + Intronic
1062525046 9:136974811-136974833 CTGTCTCCACCCTGGGGCCCCGG - Intergenic
1062573116 9:137194579-137194601 CGGTCCCAGCAGGGGGGCCGCGG + Intronic
1062625900 9:137441452-137441474 TGGCCTCAGCCTGCGGGCCCTGG - Intronic
1203759165 EBV:3070-3092 CGATCACAGCACTGGGGCCCGGG - Intergenic
1189309241 X:40008517-40008539 CGGTCTCAGGCCGGGGCGCTGGG - Intergenic
1196734749 X:118974091-118974113 CAGTCCCAGCCCGAGAGCCCTGG - Intergenic
1198310242 X:135422553-135422575 CGGTCTCAGCCCGGGGGCCCTGG + Intergenic
1199710115 X:150462996-150463018 TGATCTCTGCCCGGTGGCCCTGG + Intronic
1200237043 X:154472760-154472782 AGGGCTCAGCCCGGGGACCCAGG - Exonic
1201351510 Y:13047702-13047724 AAGTCACAGCCCGGGGGCACGGG + Intergenic