ID: 1198314016

View in Genome Browser
Species Human (GRCh38)
Location X:135448985-135449007
Sequence TTGTTGTTTTGGAGGAAAAA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1198314016_1198314019 12 Left 1198314016 X:135448985-135449007 CCTTTTTTCCTCCAAAACAACAA No data
Right 1198314019 X:135449020-135449042 CGACAACAACAACAACTTGACGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1198314016 Original CRISPR TTGTTGTTTTGGAGGAAAAA AGG (reversed) Intergenic
No off target data available for this crispr