ID: 1198314900

View in Genome Browser
Species Human (GRCh38)
Location X:135455426-135455448
Sequence CAAGCTACTCCTACTAAAAC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1198314897_1198314900 3 Left 1198314897 X:135455400-135455422 CCCTAAAATGTAAAACAAATCAA No data
Right 1198314900 X:135455426-135455448 CAAGCTACTCCTACTAAAACTGG No data
1198314898_1198314900 2 Left 1198314898 X:135455401-135455423 CCTAAAATGTAAAACAAATCAAA No data
Right 1198314900 X:135455426-135455448 CAAGCTACTCCTACTAAAACTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1198314900 Original CRISPR CAAGCTACTCCTACTAAAAC TGG Intergenic
No off target data available for this crispr