ID: 1198315905

View in Genome Browser
Species Human (GRCh38)
Location X:135465916-135465938
Sequence CAGAATAGCCAAAATTATCC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1198315903_1198315905 7 Left 1198315903 X:135465886-135465908 CCTAACATTTATATGGAATCACA No data
Right 1198315905 X:135465916-135465938 CAGAATAGCCAAAATTATCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1198315905 Original CRISPR CAGAATAGCCAAAATTATCC TGG Intergenic
No off target data available for this crispr