ID: 1198315920

View in Genome Browser
Species Human (GRCh38)
Location X:135466083-135466105
Sequence TGAAAACGAGTTCACTGTAG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1198315920_1198315925 4 Left 1198315920 X:135466083-135466105 CCCCTACAGTGAACTCGTTTTCA No data
Right 1198315925 X:135466110-135466132 AGGTGCCAAGAACATACACTGGG 0: 189
1: 513
2: 900
3: 1329
4: 1819
1198315920_1198315924 3 Left 1198315920 X:135466083-135466105 CCCCTACAGTGAACTCGTTTTCA No data
Right 1198315924 X:135466109-135466131 AAGGTGCCAAGAACATACACTGG 0: 214
1: 540
2: 1020
3: 1388
4: 1934
1198315920_1198315926 5 Left 1198315920 X:135466083-135466105 CCCCTACAGTGAACTCGTTTTCA No data
Right 1198315926 X:135466111-135466133 GGTGCCAAGAACATACACTGGGG 0: 169
1: 479
2: 904
3: 1357
4: 1875
1198315920_1198315928 28 Left 1198315920 X:135466083-135466105 CCCCTACAGTGAACTCGTTTTCA No data
Right 1198315928 X:135466134-135466156 AAAAGAGTCTCTTCAAAAAATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1198315920 Original CRISPR TGAAAACGAGTTCACTGTAG GGG (reversed) Intergenic
No off target data available for this crispr