ID: 1198320908

View in Genome Browser
Species Human (GRCh38)
Location X:135518315-135518337
Sequence GCTATGTTGTGAACAGCCAA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1198320906_1198320908 -10 Left 1198320906 X:135518302-135518324 CCCTGAAGTAGCAGCTATGTTGT No data
Right 1198320908 X:135518315-135518337 GCTATGTTGTGAACAGCCAATGG No data
1198320904_1198320908 20 Left 1198320904 X:135518272-135518294 CCATCTTGGAGTAAGAGATTTCT No data
Right 1198320908 X:135518315-135518337 GCTATGTTGTGAACAGCCAATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1198320908 Original CRISPR GCTATGTTGTGAACAGCCAA TGG Intergenic
No off target data available for this crispr