ID: 1198320993

View in Genome Browser
Species Human (GRCh38)
Location X:135519196-135519218
Sequence CACTTCAACCCAGGAGACGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1198320993_1198320999 9 Left 1198320993 X:135519196-135519218 CCTCCGTCTCCTGGGTTGAAGTG No data
Right 1198320999 X:135519228-135519250 CCTCAGCCTCCCAAGTAGCTGGG 0: 92836
1: 203589
2: 246027
3: 262461
4: 302975
1198320993_1198320997 8 Left 1198320993 X:135519196-135519218 CCTCCGTCTCCTGGGTTGAAGTG No data
Right 1198320997 X:135519227-135519249 GCCTCAGCCTCCCAAGTAGCTGG 0: 81212
1: 190903
2: 234468
3: 228974
4: 272812
1198320993_1198321001 17 Left 1198320993 X:135519196-135519218 CCTCCGTCTCCTGGGTTGAAGTG No data
Right 1198321001 X:135519236-135519258 TCCCAAGTAGCTGGGACTACAGG 0: 41425
1: 153414
2: 219429
3: 225665
4: 454725

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1198320993 Original CRISPR CACTTCAACCCAGGAGACGG AGG (reversed) Intergenic
No off target data available for this crispr