ID: 1198321452

View in Genome Browser
Species Human (GRCh38)
Location X:135521743-135521765
Sequence CGCGAGGGTCGCCGCGCGGG GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 143
Summary {0: 1, 1: 0, 2: 1, 3: 11, 4: 130}

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1198321435_1198321452 23 Left 1198321435 X:135521697-135521719 CCCGGAGGGAGGCTGCGAGGCGG 0: 1
1: 1
2: 2
3: 44
4: 403
Right 1198321452 X:135521743-135521765 CGCGAGGGTCGCCGCGCGGGGGG 0: 1
1: 0
2: 1
3: 11
4: 130
1198321437_1198321452 22 Left 1198321437 X:135521698-135521720 CCGGAGGGAGGCTGCGAGGCGGG 0: 1
1: 0
2: 0
3: 29
4: 301
Right 1198321452 X:135521743-135521765 CGCGAGGGTCGCCGCGCGGGGGG 0: 1
1: 0
2: 1
3: 11
4: 130
1198321440_1198321452 -1 Left 1198321440 X:135521721-135521743 CCCGCCCCTTCGAGGCGCACCGC 0: 1
1: 0
2: 2
3: 1
4: 71
Right 1198321452 X:135521743-135521765 CGCGAGGGTCGCCGCGCGGGGGG 0: 1
1: 0
2: 1
3: 11
4: 130
1198321441_1198321452 -2 Left 1198321441 X:135521722-135521744 CCGCCCCTTCGAGGCGCACCGCG 0: 1
1: 0
2: 0
3: 0
4: 47
Right 1198321452 X:135521743-135521765 CGCGAGGGTCGCCGCGCGGGGGG 0: 1
1: 0
2: 1
3: 11
4: 130
1198321443_1198321452 -6 Left 1198321443 X:135521726-135521748 CCCTTCGAGGCGCACCGCGCGAG 0: 1
1: 0
2: 0
3: 0
4: 8
Right 1198321452 X:135521743-135521765 CGCGAGGGTCGCCGCGCGGGGGG 0: 1
1: 0
2: 1
3: 11
4: 130
1198321444_1198321452 -7 Left 1198321444 X:135521727-135521749 CCTTCGAGGCGCACCGCGCGAGG 0: 1
1: 0
2: 0
3: 3
4: 25
Right 1198321452 X:135521743-135521765 CGCGAGGGTCGCCGCGCGGGGGG 0: 1
1: 0
2: 1
3: 11
4: 130
1198321432_1198321452 30 Left 1198321432 X:135521690-135521712 CCCGAAACCCGGAGGGAGGCTGC 0: 1
1: 0
2: 2
3: 22
4: 180
Right 1198321452 X:135521743-135521765 CGCGAGGGTCGCCGCGCGGGGGG 0: 1
1: 0
2: 1
3: 11
4: 130
1198321442_1198321452 -5 Left 1198321442 X:135521725-135521747 CCCCTTCGAGGCGCACCGCGCGA 0: 1
1: 0
2: 0
3: 1
4: 7
Right 1198321452 X:135521743-135521765 CGCGAGGGTCGCCGCGCGGGGGG 0: 1
1: 0
2: 1
3: 11
4: 130
1198321433_1198321452 29 Left 1198321433 X:135521691-135521713 CCGAAACCCGGAGGGAGGCTGCG 0: 1
1: 0
2: 0
3: 5
4: 93
Right 1198321452 X:135521743-135521765 CGCGAGGGTCGCCGCGCGGGGGG 0: 1
1: 0
2: 1
3: 11
4: 130

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1198321452 Original CRISPR CGCGAGGGTCGCCGCGCGGG GGG Intronic
900100679 1:960808-960830 GGCGGGGGTCGGGGCGCGGGGGG + Intronic
900190019 1:1349308-1349330 CGCGAGGGACGCAGCACGGAGGG + Intronic
902336855 1:15758959-15758981 CTCCAGGGGCGCCGCGCCGGGGG - Intronic
905626328 1:39492336-39492358 TCCGAGGGTCCCCGCGCGGGCGG - Intronic
905670567 1:39788119-39788141 TCCGAGGGTCCCCGCGCGGGCGG + Intronic
907413962 1:54301560-54301582 CGCGAGGGTCCCCGCGTGGGAGG - Intronic
912716872 1:111989526-111989548 CGCGCGGGGCGCCGGGCGCGGGG - Intergenic
912878954 1:113390404-113390426 CGCGCCGGGCGCCGCGCGGCGGG + Intergenic
916144497 1:161727010-161727032 CGCCAGGGTCGGCGTCCGGGAGG - Intronic
920886867 1:209938116-209938138 CGCGAGGGGCGCCGCGGGCGGGG - Intergenic
922917654 1:229271394-229271416 CGCGCGGGTCGGGCCGCGGGGGG + Intronic
1074056037 10:109923513-109923535 CGCGAGAGCCGGCGGGCGGGCGG + Exonic
1075040688 10:119104536-119104558 TGCGAGGGGCGCTGCGCGGGCGG + Intronic
1078057523 11:8019640-8019662 CGCCAGGGTCGCTCCGCCGGGGG + Intronic
1078594624 11:12675104-12675126 CGCGGGGGGCGCGGCGCGGCCGG - Intronic
1080385751 11:31810284-31810306 CCCGAGGGCCGGCGGGCGGGCGG + Intronic
1082789226 11:57335748-57335770 CGCGAGGGCCCCGGCGCGAGAGG + Exonic
1082986191 11:59172698-59172720 CGCGCCGGCCCCCGCGCGGGGGG + Exonic
1083318178 11:61828860-61828882 CGCGTGGGTCCCGGCGCGCGCGG - Intronic
1083460030 11:62805200-62805222 CGCGGGGAGCGGCGCGCGGGGGG - Intronic
1083753658 11:64777945-64777967 CGCGAGAGGCGTCGCGCGGACGG - Intronic
1084610959 11:70202720-70202742 CGCGAGGGTCCCCGCGTGCCCGG - Intergenic
1084715883 11:70873060-70873082 CCTGAGGGTCGCCACCCGGGAGG - Intronic
1089262398 11:117232141-117232163 CGCGGGGGTCGCCGGGCCGCAGG - Exonic
1089479298 11:118791819-118791841 CGCGGGGGGCGCTGCGCGGTGGG + Intergenic
1091550194 12:1530714-1530736 CGCGGGGCTGGCGGCGCGGGCGG - Intronic
1092256088 12:6927660-6927682 CGCGAGGCAAGCCGCGAGGGGGG - Intronic
1096495468 12:52037187-52037209 GGCGGGGGGCGCCGCGCGGCCGG + Intronic
1096710525 12:53452262-53452284 GGCGAGGGGGGCCCCGCGGGCGG - Exonic
1097155020 12:57006266-57006288 GGCCGGGGTCGGCGCGCGGGCGG + Intronic
1097284267 12:57865465-57865487 CGCGAGGGCCCCAGCGCTGGCGG - Intergenic
1102853879 12:116277262-116277284 CGCGAGGGCCGGCGGGCAGGCGG + Exonic
1103563561 12:121804506-121804528 CGAGACGGTGGCCGAGCGGGCGG + Intronic
1105022967 12:132829245-132829267 CGCGAAGGGCGCCGGCCGGGTGG - Intronic
1106498789 13:30307485-30307507 CGCGGTGGGCGCAGCGCGGGAGG + Intergenic
1119743569 14:77028717-77028739 CGCGCGGGATGCCGCCCGGGCGG + Intergenic
1121648151 14:95535129-95535151 CGCTGGGGGCGCGGCGCGGGCGG + Exonic
1123024867 14:105419838-105419860 CGGGAGGGCCGCGGCGCGGGCGG - Exonic
1126137157 15:45403080-45403102 CGCGCGGGTAGCGGAGCGGGAGG - Exonic
1127342880 15:58065775-58065797 CGTGAGGGCCGAGGCGCGGGGGG + Exonic
1127480375 15:59372180-59372202 TGCGAGGGGCACGGCGCGGGAGG - Intronic
1132145653 15:99427823-99427845 CGCGTGGGTGGACGCGTGGGTGG + Intergenic
1132145656 15:99427835-99427857 CGCGTGGGTGGACGCGTGGGTGG + Intergenic
1132145659 15:99427847-99427869 CGCGTGGGTGGACGCGTGGGTGG + Intergenic
1132398215 15:101489522-101489544 CGCCAGGGACGCGGCGCGAGCGG + Exonic
1132942395 16:2514519-2514541 CGCGAGGGGGGCGGCGCGAGGGG + Intronic
1132978346 16:2721383-2721405 GGCGCGGGGCGCGGCGCGGGCGG + Intergenic
1133286663 16:4693901-4693923 GGCGAGGGTGCCGGCGCGGGCGG + Intronic
1139410053 16:66751665-66751687 CGCGAGGGACGGCGAGCGGGGGG - Exonic
1141959052 16:87392467-87392489 GGTGAGTGTCGCCGCGAGGGCGG + Exonic
1142141156 16:88473451-88473473 CTCGAGGGCCGCAGGGCGGGAGG + Intronic
1142240197 16:88941424-88941446 CGCCATGGGCGCCGGGCGGGAGG - Intronic
1143635771 17:8163040-8163062 CGCGAGCGGGGCCGCGGGGGCGG + Intronic
1144764172 17:17723914-17723936 CGCGAGAGGCGCGGCGCGCGCGG + Intronic
1151586695 17:75012977-75012999 CGTGATGGTCGCCGCGGGAGGGG + Intronic
1151662381 17:75525684-75525706 CCCCAGGCTCGCCGCGCCGGAGG + Intronic
1153541392 18:6159622-6159644 CGCGATGGTCCCTGCACGGGAGG + Intronic
1155392467 18:25351041-25351063 CGCGAGGGAGGCCGAGCGGAGGG - Intronic
1156099678 18:33578501-33578523 CGCGGGGGGAGGCGCGCGGGCGG - Intergenic
1157613963 18:48976055-48976077 CTCCCGGGGCGCCGCGCGGGTGG + Intergenic
1158523922 18:58195481-58195503 CGCGAGGGTGCCCGGGTGGGTGG + Intronic
1160204684 18:76822814-76822836 CGGGCGGGCCGCAGCGCGGGCGG + Intronic
1160690982 19:460664-460686 CGCGGGGGTCGCGGGGCGGGCGG - Exonic
1160935560 19:1592864-1592886 AGCGCGGGGCCCCGCGCGGGCGG - Intergenic
1161027311 19:2042572-2042594 CGGCAGGGTGGCCCCGCGGGAGG - Intronic
1161172527 19:2820138-2820160 CACGGAGGTCGCGGCGCGGGAGG - Intronic
1162315493 19:9936159-9936181 GGCGGGGGTCGCAGCGGGGGAGG - Intronic
1162732030 19:12724045-12724067 CGCCAGGGTCGCCGCGCTTTGGG + Intergenic
1162797568 19:13094798-13094820 CGCGGGGGTCCCCGGGCTGGAGG - Exonic
1164693124 19:30225716-30225738 TGCGGGGGGCGCGGCGCGGGGGG + Intergenic
1165089262 19:33374031-33374053 CGCGAGGCTGGAGGCGCGGGCGG + Intronic
1165412915 19:35673352-35673374 GGCGAGGGTCCCGGCGCGGCGGG + Intronic
1167080612 19:47274392-47274414 CGCGCGGGAACCCGCGCGGGAGG + Intergenic
1167587663 19:50384115-50384137 CGTGAAGGTAGCCGCGCGGAGGG + Intergenic
1168235946 19:55063181-55063203 TGCGAGGGGCGGGGCGCGGGCGG + Intronic
1168257222 19:55173603-55173625 CGGGAGGGTGGCCGTGGGGGCGG - Exonic
1168696873 19:58408703-58408725 CGTGAGGGGCGCCGAGCGAGGGG + Exonic
927476839 2:23420158-23420180 CGTGAGGGTCGCTGGGCAGGAGG - Intronic
928420938 2:31137666-31137688 CGCGAGGGTCCCGGGGCGGAGGG - Intronic
940954427 2:159712418-159712440 CGCGAGAGTGGCGGCGCGGCGGG - Intergenic
946295632 2:218781800-218781822 CGCGAGGGTCGCCTTGGGTGGGG + Exonic
1171724438 20:28603060-28603082 GGCGACGGTCCCCGCGGGGGCGG + Intergenic
1171769964 20:29314713-29314735 GGGGAGGGTGGCCGCGCTGGAGG + Intergenic
1171858905 20:30376938-30376960 GGCGACGGTCCCCGCGGGGGCGG - Intergenic
1174017758 20:47502272-47502294 CGAGGGGGTCCCCGCGCGGAGGG + Intronic
1176548957 21:8213406-8213428 CGCGAGGCGAGCCGGGCGGGCGG - Intergenic
1176556850 21:8257618-8257640 CGCGAGGCGAGCCGGGCGGGCGG - Intergenic
1176567886 21:8396436-8396458 CGCGAGGCGAGCCGGGCGGGCGG - Intergenic
1176575790 21:8440655-8440677 CGCGAGGCGAGCCGGGCGGGCGG - Intergenic
1180297984 22:10961734-10961756 GGCGACGGTCCCCGCGGGGGCGG + Intergenic
1182278690 22:29206003-29206025 CGCGAGGGGCCGCGCGCGGAGGG + Exonic
1183720182 22:39557894-39557916 CGCGGGGGGCGGCGGGCGGGGGG - Intergenic
1183994060 22:41620333-41620355 CACGAGGGGCACCGCGCGGCAGG + Intronic
1184712755 22:46262846-46262868 CGCGGGGGAGGCCGGGCGGGCGG + Exonic
1185268665 22:49918456-49918478 CGCGAGGGGCGGGGAGCGGGAGG + Exonic
1203253841 22_KI270733v1_random:129713-129735 CGCGAGGCGAGCCGGGCGGGCGG - Intergenic
1203261897 22_KI270733v1_random:174792-174814 CGCGAGGCGAGCCGGGCGGGCGG - Intergenic
959849831 3:111072401-111072423 CGCGCGGGTCGCCGTGCGGATGG + Intronic
961389105 3:126541939-126541961 CGCGCGGGTCGCCGCGGGCTTGG - Exonic
963168171 3:142225631-142225653 CGCGCCGGCGGCCGCGCGGGAGG + Intergenic
963503795 3:146160830-146160852 CGCGAGGCTCGGCCGGCGGGGGG - Intronic
967904033 3:194486596-194486618 CGCGAGGGAGGCCGCGGAGGAGG - Intronic
968701217 4:2059115-2059137 CGCGAGGGGCCCGGCACGGGCGG - Intergenic
969379415 4:6783679-6783701 GGCGCGGGGCGCGGCGCGGGGGG + Intronic
970824168 4:20253039-20253061 CGCCAAGGACGCCGAGCGGGAGG + Intergenic
977908268 4:102501591-102501613 CGCCATGGCCGCAGCGCGGGCGG - Exonic
981034005 4:140152211-140152233 AGCGAGGGTGGCTGCGCGCGGGG - Intronic
990381919 5:55227320-55227342 GGGGAGGACCGCCGCGCGGGAGG + Intergenic
990954875 5:61331782-61331804 CTCGTGGGTCGCAGCGGGGGAGG - Intergenic
1002526156 5:179817119-179817141 CGCTGGCGTCGCCGCTCGGGTGG + Intronic
1002581025 5:180209413-180209435 CGCCAGGGTCCGCGCGCGGGAGG - Intergenic
1003175890 6:3751965-3751987 CGCGAGGGAGGAGGCGCGGGGGG - Exonic
1003290843 6:4776837-4776859 CGGGAGGGGCGGCGGGCGGGGGG - Intronic
1003870405 6:10398356-10398378 CCGGAGGGTGGGCGCGCGGGGGG + Exonic
1004664084 6:17735275-17735297 CGGGCGGCTCGCCGGGCGGGGGG + Intergenic
1011193942 6:84763656-84763678 GGCGCGGGTCGCCGAGTGGGCGG + Intronic
1015244772 6:131063336-131063358 CGCGGGGGTTTCCGCGCCGGGGG - Intergenic
1018754738 6:166839171-166839193 CGCGCGGGTCCCCCAGCGGGTGG - Intronic
1018911127 6:168101397-168101419 CGCGTGGGTCTCCGCGGGCGGGG - Intergenic
1019475422 7:1241824-1241846 GGCGAGGGGCGCCGGGCGCGGGG - Intergenic
1026825402 7:73578445-73578467 CGCGGGGGTGGCTGCGCGCGGGG - Exonic
1027421187 7:78019593-78019615 CGCGGCGGACGCGGCGCGGGCGG - Exonic
1031369738 7:120950598-120950620 AGCGAGGGTTGGCGCGCTGGCGG - Intergenic
1033050847 7:138002498-138002520 CGCGAGAGTTGTTGCGCGGGGGG + Intronic
1035282541 7:157787037-157787059 CGCGGGGGTGGCTGCCCGGGAGG + Intronic
1035282559 7:157787082-157787104 CGCGGGGGTGGCTGCCCGGGAGG + Intronic
1035282577 7:157787127-157787149 CGCGGGGGTGGCTGCCCGGGAGG + Intronic
1035374023 7:158395673-158395695 CGCGAGGGGCGAGGCGCGAGGGG + Intronic
1036723546 8:11200438-11200460 CGCCAGGGGCGGCGCGCGGCCGG + Intronic
1037855416 8:22367663-22367685 AGCGTGGGTCGCCGCGCCGAAGG + Intronic
1039996793 8:42541405-42541427 GGCGGGGGTCGCGGCGCGGTAGG + Intronic
1049460880 8:142727196-142727218 CGCGAGGGCGGCCGAGGGGGAGG - Exonic
1056475281 9:86946761-86946783 CGCGATGGTGGCCGCGCTGCTGG - Exonic
1058176050 9:101737776-101737798 AGCGCGGCTGGCCGCGCGGGGGG + Exonic
1060555016 9:124503644-124503666 CGCGACGGGGTCCGCGCGGGAGG - Intronic
1061128213 9:128689744-128689766 CGCGGGGGGCGCCGGGCGGGGGG + Intronic
1061840607 9:133356665-133356687 CGCAAGGTTCGCAGCGCGGGAGG + Exonic
1203449645 Un_GL000219v1:99869-99891 GGCGACGGTCTCCGCGGGGGCGG + Intergenic
1203470241 Un_GL000220v1:112857-112879 CGCGAGGCGAGCCGGGCGGGCGG - Intergenic
1203478062 Un_GL000220v1:156829-156851 CGCGAGGCGAGCCGGGCGGGCGG - Intergenic
1189418192 X:40832963-40832985 CGCCAGGCTGGCCGCGCTGGAGG - Intergenic
1198321452 X:135521743-135521765 CGCGAGGGTCGCCGCGCGGGGGG + Intronic
1200787583 Y:7273850-7273872 CGGCTGGGTCGCCGCCCGGGCGG + Intergenic