ID: 1198327472

View in Genome Browser
Species Human (GRCh38)
Location X:135587558-135587580
Sequence GTTTCTTAGCTGAGAGAGGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1198327472_1198327477 10 Left 1198327472 X:135587558-135587580 CCCTCCTCTCTCAGCTAAGAAAC No data
Right 1198327477 X:135587591-135587613 CTTAAAGACAGCATTAACCAAGG No data
1198327472_1198327478 11 Left 1198327472 X:135587558-135587580 CCCTCCTCTCTCAGCTAAGAAAC No data
Right 1198327478 X:135587592-135587614 TTAAAGACAGCATTAACCAAGGG No data
1198327472_1198327479 12 Left 1198327472 X:135587558-135587580 CCCTCCTCTCTCAGCTAAGAAAC No data
Right 1198327479 X:135587593-135587615 TAAAGACAGCATTAACCAAGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1198327472 Original CRISPR GTTTCTTAGCTGAGAGAGGA GGG (reversed) Intergenic
No off target data available for this crispr