ID: 1198329830

View in Genome Browser
Species Human (GRCh38)
Location X:135611979-135612001
Sequence GCATGCATAGTGTCATGAAG GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1198329826_1198329830 -5 Left 1198329826 X:135611961-135611983 CCTACTTGGTTTCCATTTGCATG No data
Right 1198329830 X:135611979-135612001 GCATGCATAGTGTCATGAAGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1198329830 Original CRISPR GCATGCATAGTGTCATGAAG GGG Intergenic
No off target data available for this crispr