ID: 1198331763

View in Genome Browser
Species Human (GRCh38)
Location X:135628961-135628983
Sequence AGGGAGTCCTCGCCAAAAAC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1198331763_1198331766 -2 Left 1198331763 X:135628961-135628983 CCAGTTTTTGGCGAGGACTCCCT No data
Right 1198331766 X:135628982-135629004 CTGTTTCTCTGCCACATATAAGG No data
1198331763_1198331768 30 Left 1198331763 X:135628961-135628983 CCAGTTTTTGGCGAGGACTCCCT No data
Right 1198331768 X:135629014-135629036 TTTCCAAGTCATGAATTTCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1198331763 Original CRISPR AGGGAGTCCTCGCCAAAAAC TGG (reversed) Intergenic
No off target data available for this crispr