ID: 1198334387

View in Genome Browser
Species Human (GRCh38)
Location X:135652535-135652557
Sequence GAGGGGTATTACAAGGTGAT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1198334387_1198334392 2 Left 1198334387 X:135652535-135652557 CCAATCACCTTGTAATACCCCTC No data
Right 1198334392 X:135652560-135652582 CTACCAGTCTTAAAACCAAATGG No data
1198334387_1198334396 16 Left 1198334387 X:135652535-135652557 CCAATCACCTTGTAATACCCCTC No data
Right 1198334396 X:135652574-135652596 ACCAAATGGGGAATATCAACTGG No data
1198334387_1198334394 4 Left 1198334387 X:135652535-135652557 CCAATCACCTTGTAATACCCCTC No data
Right 1198334394 X:135652562-135652584 ACCAGTCTTAAAACCAAATGGGG No data
1198334387_1198334393 3 Left 1198334387 X:135652535-135652557 CCAATCACCTTGTAATACCCCTC No data
Right 1198334393 X:135652561-135652583 TACCAGTCTTAAAACCAAATGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1198334387 Original CRISPR GAGGGGTATTACAAGGTGAT TGG (reversed) Intergenic
No off target data available for this crispr