ID: 1198340311

View in Genome Browser
Species Human (GRCh38)
Location X:135707736-135707758
Sequence AAACCCTGTCTCAAAAAGAA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1198340311_1198340317 10 Left 1198340311 X:135707736-135707758 CCATTCTTTTTGAGACAGGGTTT No data
Right 1198340317 X:135707769-135707791 CCCAAGGTGGAGTGCAGTGGCGG 0: 3
1: 127
2: 6342
3: 3941
4: 2888
1198340311_1198340315 7 Left 1198340311 X:135707736-135707758 CCATTCTTTTTGAGACAGGGTTT No data
Right 1198340315 X:135707766-135707788 TCGCCCAAGGTGGAGTGCAGTGG 0: 13
1: 1931
2: 74850
3: 235836
4: 248501
1198340311_1198340320 18 Left 1198340311 X:135707736-135707758 CCATTCTTTTTGAGACAGGGTTT No data
Right 1198340320 X:135707777-135707799 GGAGTGCAGTGGCGGGATCTCGG 0: 4055
1: 41530
2: 123968
3: 157541
4: 114695
1198340311_1198340313 -6 Left 1198340311 X:135707736-135707758 CCATTCTTTTTGAGACAGGGTTT No data
Right 1198340313 X:135707753-135707775 GGGTTTGGTTCTGTCGCCCAAGG No data
1198340311_1198340319 11 Left 1198340311 X:135707736-135707758 CCATTCTTTTTGAGACAGGGTTT No data
Right 1198340319 X:135707770-135707792 CCAAGGTGGAGTGCAGTGGCGGG 0: 3
1: 147
2: 6810
3: 5505
4: 4420
1198340311_1198340321 25 Left 1198340311 X:135707736-135707758 CCATTCTTTTTGAGACAGGGTTT No data
Right 1198340321 X:135707784-135707806 AGTGGCGGGATCTCGGCTCAAGG No data
1198340311_1198340314 -3 Left 1198340311 X:135707736-135707758 CCATTCTTTTTGAGACAGGGTTT No data
Right 1198340314 X:135707756-135707778 TTTGGTTCTGTCGCCCAAGGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1198340311 Original CRISPR AAACCCTGTCTCAAAAAGAA TGG (reversed) Intergenic
No off target data available for this crispr