ID: 1198343791

View in Genome Browser
Species Human (GRCh38)
Location X:135740452-135740474
Sequence AACCCTGTCTCAAAAAGAAT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1198343791_1198343796 8 Left 1198343791 X:135740452-135740474 CCCATTCTTTTTGAGACAGGGTT No data
Right 1198343796 X:135740483-135740505 TTGCCCAAGGTGGAGTGCAGTGG No data
1198343791_1198343795 -2 Left 1198343791 X:135740452-135740474 CCCATTCTTTTTGAGACAGGGTT No data
Right 1198343795 X:135740473-135740495 TTTGGCTCTGTTGCCCAAGGTGG No data
1198343791_1198343794 -5 Left 1198343791 X:135740452-135740474 CCCATTCTTTTTGAGACAGGGTT No data
Right 1198343794 X:135740470-135740492 GGGTTTGGCTCTGTTGCCCAAGG No data
1198343791_1198343799 19 Left 1198343791 X:135740452-135740474 CCCATTCTTTTTGAGACAGGGTT No data
Right 1198343799 X:135740494-135740516 GGAGTGCAGTGGCACGATCTCGG No data
1198343791_1198343800 26 Left 1198343791 X:135740452-135740474 CCCATTCTTTTTGAGACAGGGTT No data
Right 1198343800 X:135740501-135740523 AGTGGCACGATCTCGGCTGATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1198343791 Original CRISPR AACCCTGTCTCAAAAAGAAT GGG (reversed) Intergenic