ID: 1198343792

View in Genome Browser
Species Human (GRCh38)
Location X:135740453-135740475
Sequence AAACCCTGTCTCAAAAAGAA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1198343792_1198343799 18 Left 1198343792 X:135740453-135740475 CCATTCTTTTTGAGACAGGGTTT No data
Right 1198343799 X:135740494-135740516 GGAGTGCAGTGGCACGATCTCGG 0: 17558
1: 81368
2: 137386
3: 137317
4: 92455
1198343792_1198343800 25 Left 1198343792 X:135740453-135740475 CCATTCTTTTTGAGACAGGGTTT No data
Right 1198343800 X:135740501-135740523 AGTGGCACGATCTCGGCTGATGG No data
1198343792_1198343795 -3 Left 1198343792 X:135740453-135740475 CCATTCTTTTTGAGACAGGGTTT No data
Right 1198343795 X:135740473-135740495 TTTGGCTCTGTTGCCCAAGGTGG No data
1198343792_1198343796 7 Left 1198343792 X:135740453-135740475 CCATTCTTTTTGAGACAGGGTTT No data
Right 1198343796 X:135740483-135740505 TTGCCCAAGGTGGAGTGCAGTGG 0: 43
1: 3094
2: 78757
3: 188983
4: 232919
1198343792_1198343794 -6 Left 1198343792 X:135740453-135740475 CCATTCTTTTTGAGACAGGGTTT No data
Right 1198343794 X:135740470-135740492 GGGTTTGGCTCTGTTGCCCAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1198343792 Original CRISPR AAACCCTGTCTCAAAAAGAA TGG (reversed) Intergenic
No off target data available for this crispr