ID: 1198343794

View in Genome Browser
Species Human (GRCh38)
Location X:135740470-135740492
Sequence GGGTTTGGCTCTGTTGCCCA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1198343791_1198343794 -5 Left 1198343791 X:135740452-135740474 CCCATTCTTTTTGAGACAGGGTT No data
Right 1198343794 X:135740470-135740492 GGGTTTGGCTCTGTTGCCCAAGG No data
1198343792_1198343794 -6 Left 1198343792 X:135740453-135740475 CCATTCTTTTTGAGACAGGGTTT No data
Right 1198343794 X:135740470-135740492 GGGTTTGGCTCTGTTGCCCAAGG No data
1198343786_1198343794 29 Left 1198343786 X:135740418-135740440 CCATGAACTTACTGGCGGTCAGG No data
Right 1198343794 X:135740470-135740492 GGGTTTGGCTCTGTTGCCCAAGG No data
1198343790_1198343794 -4 Left 1198343790 X:135740451-135740473 CCCCATTCTTTTTGAGACAGGGT No data
Right 1198343794 X:135740470-135740492 GGGTTTGGCTCTGTTGCCCAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1198343794 Original CRISPR GGGTTTGGCTCTGTTGCCCA AGG Intergenic