ID: 1198343795

View in Genome Browser
Species Human (GRCh38)
Location X:135740473-135740495
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1198343790_1198343795 -1 Left 1198343790 X:135740451-135740473 CCCCATTCTTTTTGAGACAGGGT No data
Right 1198343795 X:135740473-135740495 TTTGGCTCTGTTGCCCAAGGTGG No data
1198343791_1198343795 -2 Left 1198343791 X:135740452-135740474 CCCATTCTTTTTGAGACAGGGTT No data
Right 1198343795 X:135740473-135740495 TTTGGCTCTGTTGCCCAAGGTGG No data
1198343792_1198343795 -3 Left 1198343792 X:135740453-135740475 CCATTCTTTTTGAGACAGGGTTT No data
Right 1198343795 X:135740473-135740495 TTTGGCTCTGTTGCCCAAGGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1198343795 Original CRISPR TTTGGCTCTGTTGCCCAAGG TGG Intergenic