ID: 1198343797 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | X:135740486-135740508 |
| Sequence | GTGCCACTGCACTCCACCTT GGG (reversed) |
| Strand | - |
| Crispr in exon? | No |
| Crispr in intron? | No |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | 447274 | |||
| Summary | {0: 23, 1: 2368, 2: 62525, 3: 163686, 4: 218672} |
Found 2 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 1198343797_1198343800 | -8 | Left | 1198343797 | X:135740486-135740508 | CCCAAGGTGGAGTGCAGTGGCAC | 0: 23 1: 2368 2: 62525 3: 163686 4: 218672 |
||
| Right | 1198343800 | X:135740501-135740523 | AGTGGCACGATCTCGGCTGATGG | No data | ||||
| 1198343797_1198343801 | 10 | Left | 1198343797 | X:135740486-135740508 | CCCAAGGTGGAGTGCAGTGGCAC | 0: 23 1: 2368 2: 62525 3: 163686 4: 218672 |
||
| Right | 1198343801 | X:135740519-135740541 | GATGGCAACTTCTGCCTCCCAGG | No data |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 1198343797 | Original CRISPR | GTGCCACTGCACTCCACCTT GGG (reversed) | Intergenic | ||