ID: 1198343798

View in Genome Browser
Species Human (GRCh38)
Location X:135740487-135740509
Sequence CGTGCCACTGCACTCCACCT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1198343798_1198343801 9 Left 1198343798 X:135740487-135740509 CCAAGGTGGAGTGCAGTGGCACG No data
Right 1198343801 X:135740519-135740541 GATGGCAACTTCTGCCTCCCAGG No data
1198343798_1198343800 -9 Left 1198343798 X:135740487-135740509 CCAAGGTGGAGTGCAGTGGCACG No data
Right 1198343800 X:135740501-135740523 AGTGGCACGATCTCGGCTGATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1198343798 Original CRISPR CGTGCCACTGCACTCCACCT TGG (reversed) Intergenic