ID: 1198343800

View in Genome Browser
Species Human (GRCh38)
Location X:135740501-135740523
Sequence AGTGGCACGATCTCGGCTGA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1198343797_1198343800 -8 Left 1198343797 X:135740486-135740508 CCCAAGGTGGAGTGCAGTGGCAC No data
Right 1198343800 X:135740501-135740523 AGTGGCACGATCTCGGCTGATGG No data
1198343791_1198343800 26 Left 1198343791 X:135740452-135740474 CCCATTCTTTTTGAGACAGGGTT No data
Right 1198343800 X:135740501-135740523 AGTGGCACGATCTCGGCTGATGG No data
1198343798_1198343800 -9 Left 1198343798 X:135740487-135740509 CCAAGGTGGAGTGCAGTGGCACG No data
Right 1198343800 X:135740501-135740523 AGTGGCACGATCTCGGCTGATGG No data
1198343792_1198343800 25 Left 1198343792 X:135740453-135740475 CCATTCTTTTTGAGACAGGGTTT No data
Right 1198343800 X:135740501-135740523 AGTGGCACGATCTCGGCTGATGG No data
1198343790_1198343800 27 Left 1198343790 X:135740451-135740473 CCCCATTCTTTTTGAGACAGGGT No data
Right 1198343800 X:135740501-135740523 AGTGGCACGATCTCGGCTGATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1198343800 Original CRISPR AGTGGCACGATCTCGGCTGA TGG Intergenic