ID: 1198343801 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | X:135740519-135740541 |
| Sequence | GATGGCAACTTCTGCCTCCC AGG |
| Strand | + |
| Crispr in exon? | No |
| Crispr in intron? | No |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | ||||
| Summary |
Found 2 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 1198343798_1198343801 | 9 | Left | 1198343798 | X:135740487-135740509 | CCAAGGTGGAGTGCAGTGGCACG | No data | ||
| Right | 1198343801 | X:135740519-135740541 | GATGGCAACTTCTGCCTCCCAGG | No data | ||||
| 1198343797_1198343801 | 10 | Left | 1198343797 | X:135740486-135740508 | CCCAAGGTGGAGTGCAGTGGCAC | 0: 23 1: 2368 2: 62525 3: 163686 4: 218672 |
||
| Right | 1198343801 | X:135740519-135740541 | GATGGCAACTTCTGCCTCCCAGG | No data |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 1198343801 | Original CRISPR | GATGGCAACTTCTGCCTCCC AGG | Intergenic | ||