ID: 1198363173 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | X:135915660-135915682 |
| Sequence | CCTCACATGTTGAAGAAGCA TGG (reversed) |
| Strand | - |
| Crispr in exon? | No |
| Crispr in intron? | No |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | No data | |||
| Summary | No data |
Found 3 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 1198363173_1198363177 | 7 | Left | 1198363173 | X:135915660-135915682 | CCATGCTTCTTCAACATGTGAGG | No data | ||
| Right | 1198363177 | X:135915690-135915712 | AAGGTGGCTGACTACAAGTTAGG | No data | ||||
| 1198363173_1198363176 | -9 | Left | 1198363173 | X:135915660-135915682 | CCATGCTTCTTCAACATGTGAGG | No data | ||
| Right | 1198363176 | X:135915674-135915696 | CATGTGAGGATACAGCAAGGTGG | No data | ||||
| 1198363173_1198363178 | 13 | Left | 1198363173 | X:135915660-135915682 | CCATGCTTCTTCAACATGTGAGG | No data | ||
| Right | 1198363178 | X:135915696-135915718 | GCTGACTACAAGTTAGGAAGAGG | No data |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 1198363173 | Original CRISPR | CCTCACATGTTGAAGAAGCA TGG (reversed) | Intergenic | ||
| No off target data available for this crispr | |||||